Dichotomous key for leaves

Dichotomous Key For Leaves

Answers

Answer 1

Answer:

I believe that your answer is Magnolia.


Related Questions

Why are there more producers than nutrients? (In an ecosystem, more specifically, regarding trophic levels.)

Answers

Explanation:

any step in a nutritive series, or food chain, of an ecosystem dead organisms and waste materials into nutrients usable by the producers

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ

Answers

Answer:

01). cells

02).seeing inside the cells

03).Robert hook

Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?

Answers

Answer:

3.5264 x [tex]10^{7}[/tex]

Explanation:

The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.

In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.

So the short ton produced will be

= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102

= 3.5264 x [tex]10^{7}[/tex] short ton.

Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

Why is biodiversity important for ecosystems?

Answers

Answer:to stop from extinction

Explanation:

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS

Answers

Answer:The answer is the person and the tennis ball :)

Explanation:

A student placed a small chip of limestone into a hydrochloric acid solution, and carbon dioxide gas was released. The carbon dioxide provided evidence that
A. The formation of an element occurred.
B. Only a physical change occurred.
C. A chemical change occurred.
D. Only a loss of mass occurred.

Answers

C. A chemical change occurred.

Inherited used in a sentence

Answers

I inherited my parents genes.

How many factors should a well-designed experiment test at one time?

Answers

Answer:

Depends on the number of experiment variables.

Explanation:

You should only test one variable/factor

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

Which statements accurately describe fermentation? Select two options.

Oxygen is present during this process.
Cells may convert pyruvic acid to lactic acid.
NAD+ is converted to NADH.
Fermentation is an anaerobic process.
Additional ATP is produced after glycolysis.

Answers

Answer:

The answers are the second and fourth ones.

Explanation:

I did the assignment.

The statements that accurately describe fermentation are cells may convert pyruvic acid to lactic acid, and fermentation is an anaerobic process. The correct options are B and D.

What is fermentation?

Fermentation is an anaerobic chemical process that breaks down molecules like glucose. More specifically, fermentation is the bubbling that happens during the creation of wine and beer, a procedure that has been around for at least 10,000 years.

It is different from aerobic respiration because it occurs in the absence of oxygen and aerobic respiration occurs in the presence of oxygen. The product of fermentation is lactic acid, which is produced from pyruvic acid.

Thus, the correct options are: B, Cells may convert pyruvic acid to lactic acid, and D, Fermentation is an anaerobic process.

To learn more about fermentation, refer to the link:

https://brainly.com/question/14525128

#SPJ6

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Why might Ponyboy have idolized Pual Newman?

Answers

Ponyboy might have idolized Paul Newman because Paul Newman played many rebellious characters who Ponyboy could relate to. Some characters he played were “Fast Eddie” in The Hustler and a Southern chain gang member in Cool Hand Luke.

Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell?
A. DNA activates nerve signals in the nervous system
B. DNA speeds up chemical reactions and lowers activation energy
C. DNA protects the cell from invaders.
D. DNA determines what proteins are made.

Answers

Answer:

The answer is D: DNA determines what proteins are made.

Explanation:

The nucleotide sequences that make up DNA are a “code” for the cell to make hundreds of different types of proteins; it is these proteins that function to control and regulate cell growth, division, communication with other cells and most other cellular functions.This process is called protein synthesis.All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.

Hope this helps!! ;)

DNA controls the cell by determining what protein are synthesized by the cell. Thus, the correct option is D.

What is Translation?

Translation is the process of synthesis of proteins from the mRNA (messenger RNA) of the cell. This process occurs in the ribosome of the cell. In this process, the mRNA produced from the DNA encodes amino acids which join together to form large polypeptide and protein molecules.

mRNA are produced from DNA through the process of transcription. Transcription occurs in the nucleus of the cell. Through this process, DNA produces a sequence of mRNA which is complementary to it. This mRNA determines what proteins will be synthesized by the cell.

Therefore, the correct option is D.

Learn more about DNA here:

https://brainly.com/question/264225

#SPJ6

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes

Answers

C definitely c hope this helps

The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.

What do you mean by Genotypes?

Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.

In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.

Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).

To learn more about Gene interaction, refer to the link:

https://brainly.com/question/25217589

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

:-) :-) :-) :-) :-) :-) :-) :-) :-)

Please help

Answers

Answer:

B

Explanation:

sorry if im wrong!!!

what was not included in john dalton's description of the atom

Answers

Answer:

Nucleus containing protons and neutrons  and electrons

Explanation:

Answer:

This is what i found-

Explanation:

The indivisibility of an atom was proved wrong: an atom can be further subdivided into protons, neutrons and electrons. However an atom is the smallest particle that takes part in chemical reactions. According to Dalton, the atoms of same element are similar in all respects.

January comes once in 12 months. Saturday comes once in seven days and 12 noon comes once each day. How is this like the frequency of a wave?

Answers

This is because the frequency of of a wave is a number of repeating event per unit time.

How does the force of gravity move objects in the solar system?

Answers

Answer:

One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun

Explanation:

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells
Other Questions
I need help Y=x+4 y=3x-1 Four friends share the profit of a lawn care service equally. The friends charge $45 per lawn and spend $30 of their total earnings on gasoline for the lawnmowers each week. Which inequality can be used to find m, the number of lawns they need to mow next week so that each person earns at least $275? A. 45m - 30/4 _> 275 B. 45m/4 - 30 _>275 C. 45m - 30/4 _< 275 D. 45m/4 - 30 _< 275 convert 5/4 into a decimal Which type of reproduction is shown below What is the olest phone ever Please help me I will give you the brain thing with extra points, please help me. 3/5 A public rectangular-shaped pool is 15 m by 30 m. Public pools must be surrounded by a cementwalkway of uniform width whose area is at least as large as the area of the pool. What is theminimum width of the walkway? Show the steps of your solution. The measures of two sides of a triangle are given {17x-7} and {3x^2+5}. The perimeter of the triangle is 13x^2-14x+12. Find the measures of the third side. Select the correct answer.Someone who scores mostly "yes" answers in the social category of the RIASEC would probably not enjoy a career inA ResearchB. Social workC NursingD Teaching Anthony felt like he had finally overcome his fear of writing. Once he put pen to paper, the writing came easier and easier. He felt elated as he watched the words dance across the page. Which literary device do the bold words represent? Someone please help ASAP ill give Brainliest Find the present value of the given future payment at the specified interest rate.6000$ due in 2 years at 6.5% compounded daily What is the main function of the smooth and rough Endoplasmic Reticulum in a cell? Which diagram shows a situation that would not produce an electric current in the wire? i dont know how to do geometry like that and i need help on my assignment 2 2/5 multiplied by 2 multiplied by 3 1/5 Can someone please help me on this? I've been trying for hours and can't seem to find the answer. area of rhombus is 60m sq.if its perimeter is 40 m sq. find its altitude In a bag, you have a strip of paper with the numbers 1-10 written on the strips. If one strip of paper is pulled from the bag and then replaced, what is the probability of the following events: pick a odd number and then a even number.A: 1/2B: 1/4C: 1/5D: 1/25 The American flag, Uncle Sam, and the bald eagle are all symbols for _____.A.) the countryB.) the stateC.) the stock marketD.) the school mascot