Determine the mRNA and amino acid sequence for the below DNA sequence.

Determine The MRNA And Amino Acid Sequence For The Below DNA Sequence.

Answers

Answer 1
AUGAGCCCCGCUAGGUUCUC

Related Questions

Help me out pleaseeeeeeees

Answers

The answer is c I just did the same test

(04.05 MC)
Which claim best supports the cycling of carbon through the spheres of Earth?

Answers

Answer:

Burning fossil fuels adds the necessary amount of carbon in the atmosphere for cellular respiration to take place

b) How does adaptation affect the survival of a species? Why?

Answers

In evolutionary theory, adaptation is the biological mechanism by which organisms adjust to new environments or to changes in their current environment. This enables better survival and reproduction compared with other members of the species, leading to evolution.

Explanation:

If you want more info, you can check out this site. It is safe and secure.

https://www.nationalgeographic.org/encyclopedia/adaptation/

Apply Concepts Eventually, most people with Alzheimer's disease lose the ability to recognize common objects. Explain which lobe is affected at this point in the disease

Answers

Answer:

The right temporal lobe

Explanation:

The cerebral cortex of the brain has two sections known as hemispheres, and each hemisphere can be divided into four lobes: frontal, parietal, temporal and occipital. Alzheimer's disease is the most common cause of dementia, which is characterized by the damage of the temporal lobe. Alzheimer’s disease usually initiates in the hippocampus, which is a structure inside each temporal lobe. The temporal lobes are involved in different neuronal functions: object recognition, face recognition, perception, memory, language, emotions, etc. The right temporal lobe is mainly involved in processing visual information (i.e., face recognition, object recognition, familiar recognition).

For this structural characteristic, decide if it is a characteristic of DNA, a characteristic of RNA, a characteristic of both or a characteristic of neither? It contains thymine as a base

Answers

Answer:it is a characteristic of DNA

Explanation:

Deoxyribonucleic acid(DNA) is made 5 carbon deoxyribose sugar, phosphate group,Nitrogenous base which include purine and pyrimidine. Purine base compose of Adenine and guanine while pyrimidine base compose of Cytosine and thymine.

In Ribonucleic acid (RNA) we have 5 carbon ribose sugar, phosphate group and nitrogenous bases which are purine and pyrimidine. Purine consist of Adenine and guanine while pyrimidine compose of Cytosine and Uracil where thymine in DNA is replaced by Uracil in RNA. This makes Thymine a components of DNA not RNA.

Glycolysis that starts with glycogen instead of glucose can be considered to have a higher energy yield because:

A. Phosphorolysis reactions cleave bonds with phosphate instead of water.
B. Phosphorylase is a better enzyme than hexokinase
C. Phosphorylase produces a glucose phosphate without spending an ATP to do it
D. All of these

Answers

Answer:

A

Explanation:

The answer is a Because Phosphorolysis reactions cleave bonds with phosphate instead of water (: just trust me

Glycolysis that starts with glycogen instead of glucose can be considered to have a higher energy yield because phosphorolysis reactions cleave bonds with phosphate instead of water. The correct option is A.

What is glycolysis?

Through a sequence of processes known as glycolysis, glucose is divided into two pyruvate molecules, each of which has three carbons.

The metabolic process that changes glucose into pyruvate is known as glycolysis.

The high-energy molecules adenosine triphosphate and reduced nicotinamide adenine dinucleotide are created using the free energy released during this process. A series of ten enzyme-catalyzed processes make up glycolysis.

In contrast to phosphorolysis reactions, which cleave bonds with phosphate rather than water, glycolysis can be thought of as having a larger energy yield because it begins with glycogen rather than glucose.

Not producing adenosine 5′-triphosphate is not the primary goal of glycolysis; rather, it is to produce pyruvate for the trichloroacetic acid (TCA) cycle.

By boosting the ratio of NADH to NAD+, the glycolytic synthesis of pyruvate lowers the cytosol.

Thus, the correct option is A.

For more details regarding glycolysis, visit:

https://brainly.com/question/29604117

#SPJ5

What’s the answer to this I didn’t mean to click this btw

Answers

It’s the 4th answer, trust me.

Which of the following elements are found in ALL four biomolecules? Select all of the correct answer choices.
Carbon
Helium
Hydrogen
Oxygen
Nitrogen
Phosphorous

Answers

Answer:

everything but Helium and Phosphorous

Explanation:

How do changes to genes affect the traits of an organism

Answers

Mutations over the years effect the gene of an organism

Changes  to genes affect the traits of an organism, as genes have the capability to regulate the organism's function, and the genes can regulate the expression of proteins, which regulate the organism's phenotypic and genotypic expression.

What is the significance of the genes or the traits?

Changes in the genes can affect humans in several ways, such as through genetic mutations that result in changes to the regulation of gene expression and result in the addition or loss of entire genes from the organism. Not all of the genetic mutations lead to expressiable changes, but they may change the protein sequence by changing the polypeptide sequence.

Hence, changes to genes affect the traits of an organism, as genes have the capability to regulate the organism's function, and the genes can regulate the expression of proteins, which regulate the organism's phenotypic and genotypic expression.

Learn more about the genes or traits here.

https://brainly.com/question/11890207

#SPJ2

How can you use what you have learned in Biology to help yourself, family and the planet?

Answers

Answer: I’m not sure what you’ve learned but for me it’s that you shouldnt leave the lights on when you don’t need them, you should switch off the TV when you aren’t using it, if you see a piece of trash pick it up and throw it in a trash can, and recycle

Explanation: HAPPY (late) EARTH DAY!!

A land based global community of organisms is called a?

Answers

A terrestrial ecosystem is a land-based community of organisms.

Somebody help me with these 4 questions please

Answers

Answer:

i only know question 1 is convergent boundaries.

sorry i am not sure about the others

Explanation:

question 1 is convergent since they are sliding towards each other to form the subduction zone

how is population dynamics affected by water pollution

Answers

Answer:

As population density increases the demand for the limited fresh water also increases. in most of the case, the water is not treated properly and as such it leads to pollution of surface - level fresh water, and seeps into the ground, polluting ground water as well

What must happen for a hypothesis to become a theory?
A. It must be well-tested and have supported results every time.
B. All possible alternative hypotheses must be tested first.
C. A hypothesis must be published and tested by scientists for a decade before it is a theory.
D. A theory is developed only after a hypothesis has been refuted and changed.​

Answers

Answer:

A.it must be well-tested and have supported results every time

Answer:

Explanation:b

PLS HELP!!!
T:Have tail
t:no tail

-what percent of offspring will have a tail?-

Answers

Answer:

50 percentage

Explanation:

only the Tt will have a tail as they are hybrids and have the tail(T) as dominant characteristic

How does temperature affect rocks?

Temperature can cause rocks to expand or contract.
Temperature can change the texture of a rock.
Temperature can relocate rocks.
Temperature changes rock composition.

Answers

Answer:

temperature can cause rocks to expand and contract

When people eat shrimp, they first pull off an outer covering that in life provided protection to the animal. What is this structure?

Answers

Answer:

carapace

Explanation:

the shell which protect the cephalothorax is called the carapace

In corgis, a breed of dog, short tails are completely dominant to long tails. If two long-tailed corgis have puppies, what is the percent chance of having a puppy with a short tail?

Answers

Answer:

0%

Explanation:

This question involves a single gene coding for tail length in a breed of dog called Corgis. The allele for short tail (S) is dominant over the allele for long tail (s).

According to this question, two long-tailed corgis are crossed i.e. ss × ss. Each parent corgis will produce only 's' gametes. Using this gametes in a punnet square (see attached image), the following proportion of puppies will be produced:

All ss (long-tailed) offsprings/puppies.

Based on the question asked, 0% or none of the puppies produced will have a short tail.

Match the vocabulary word to the correct definition.

Column A
1.
This can release and store energy by breaking and re-forming the bonds between its phosphate groups:
This can release and store energy by breaking and re-forming the bonds between its phosphate groups
2.
The fluid portion of the chloroplast outside of the thylakoids is known as this:
The fluid portion of the chloroplast outside of the thylakoids is known as this
3.
The thylakoid contains this protein complex that spans the membrane and allows H+ ions to pass through it:
The thylakoid contains this protein complex that spans the membrane and allows H+ ions to pass through it
4.
this compound has two phosphate groups, adenine, and a 5 carbon sugar called ribose:
this compound has two phosphate groups, adenine, and a 5 carbon sugar called ribose
Column B
a. ATP synthase
b. ADP
c. stroma
d. ATP

Answers

Answer:

1

Explanation:

You are studying a biochemical pathway in the mold Neurospora where enzyme 1 converts the initial substrate into intermediate substrate A; enzyme 2 converts intermediate substrate A into intermediate substrate B; enzyme 3 converts intermediate substrate B into intermediate substrate C; and enzyme 4 converts intermediate substrate C into the end product, an amino acid that is essential for growth. You isolate a mutant that is unable to grow on minimal media. Which data would provide the strongest support for the hypothesis that this mutation occurred in the gene that codes for enzyme 2

Answers

Complete question:

You are studying a biochemical pathway in the mold Neurospora where enzyme 1 converts the initial substrate into intermediate substrate A; enzyme 2 converts intermediate substrate A into intermediate substrate B; enzyme 3 converts intermediate substrate B into intermediate substrate C; and enzyme 4 converts intermediate substrate C into the end product, an amino acid that is essential for growth. You isolate a mutant that is unable to grow on minimal media. Which data would provide the strongest support for the hypothesis that this mutation occurred in the gene that codes for enzyme 2?

a. The mold can grow on rich medium plus intermediate substrate C, but not on rich medium plus intermediate substrate B.

b. The mold can grow on minimal medium plus intermediate substrate B, but not on minimal medium plus the initial substrate.

c. The mold can grow on minimal medium plus intermediate substrate B, but not on minimal medium plus intermediate substrate A.

d. The mold can grow on rich medium plus intermediate substrate D, but not on rich medium plus intermediate substrate C.

e. The mold can grow on minimal medium plus intermediate substrate A, but not on minimal medium plus intermediate substrate C.

Answer:

c. The mold can grow on minimal medium plus intermediate substrate B, but not on minimal medium plus intermediate substrate A.

Explanation:

Let us first diagram the pathway for a better understanding.

The normal organism produces four enzymes that convert substrates in the medium that allow it to survive, grow, and reproduce.  

initial substrate ------------> A ----------------> B ----------------> C ----------------> AA

                           Enzyme 1       Enzyme 2        Enzyme 3         Enzyme 4

Any mutation on the Neurospora´s enzymes will not let the organism grow on the minimal medium because it will not be able to convert the minimal substrate into the following one, because the mutated enzyme will not accomplish its original function.

So if the mutation occurs in enzyme 1, the organism will not be able to convert the initial substrate into intermediate substrate A. And the rest of the reaction will not be possible either because of the lack of substance A.

initial substrate -----X----> A -------X-----> B ------X--------> C ------X-------> AA

          mutated Enzyme 1      Enzyme 2       Enzyme 3        Enzyme 4

If the mutation occurs in enzyme 2, the organism will not be able to convert the intermediate substrate A into intermediate substrate B. And the rest of the reaction will not be possible either because of the lack of substance B.

initial substrate ------------> A -------X--------> B -------X------> C --------X-----> AA

                           Enzyme 1   mutated Enz. 2     Enzyme 3         Enzyme 4

If the mutation occurs in enzyme 3, the organism will not be able to convert the intermediate substrate B into intermediate substrate C. And the last reaction will not be possible either because of the lack of substance C.

initial substrate ------------> A ----------------> B -------X--------> C -------X------> AA

                           Enzyme 1       Enzyme 2     mutated Enz. 3     Enzyme 4

And if the mutation occurs in enzyme 4, the organism will not be able to convert the intermediate substrate C into the essential amino acid.

initial substrate ------------> A ----------------> B ----------------> C -------X-------> AA

                           Enzyme 1       Enzyme 2        Enzyme 3      Mutated Enz. 4

But, if we artificially add to the medium the substrate that should be produced by the original enzyme (and that is not converted because of the mutation), then the organism will grow and survive because the other enzymes will be able to produce the essential amino acid.

So, if enzyme 2 is the only enzyme mutated, the organism will not be able to live in a medium with substrate A because the mutated enzyme will not convert the substrate A into B. There will not be B substrate in the medium, and the other enzymes will not produce the essential amino acid. So if the mutation occurs in enzyme 2, substrate A is useless to the organism because it will not survive.

But if we add the intermediate substrate B to the medium, the organism will survive. In a medium with substrate B, all the other reactions will be possible, and the organism will get the essential amino acid. The artificial addition of B substrate will replace the function of the original enzyme 2 -which is the one that converts A into B-.

A plant biologist is asked to develop strawberry plants with larger, sweeter berries. Through selective breeding, the biologist successfully produces the new strawberry plant.

What is one method the biologist can use to produce many identical strawberry plants of the same kind

Answers

Answer: Clonal progagation

Explanation:

Clonal propagation involves the production of identical individual without the fusion of germ cells. It can be multiplication through stem and other plants part such as leaves.

Strawberry as a fruits can be multiplied using the stems thus preventing the germ cells from genetic recombination that could lead to the formation of entirely new plants. It does not involve the union of male and female germ cells.

REEEEEEEEEEEEEEEEEEE PLEASE HELP MEEEEEEEEEEEEEEEE

Answers

Answer:

The answer is D

Explanation:

This is because the markup percentage of the price of riding busses mean that less people will ride it and the bus will be less active.

how natural selection contributes to the evolution of a species

Answers

The species of an organism with more favorable traits will live longer to reproduce and evolve while with natural selection, the organisms will get picked out and eaten

In a eukaryotic cell, which of the following processes directly involves DNA?

Answers

The provided question lacks the options, however, the options associated with the question is as follows;

A. translation

B. cellular respiration

C. active transport of ions

D. replication of chromosomes

Answer:

The correct answer is - D. replication of chromosomes.

Explanation:

During every cell division, either meiosis or mitotic the chromosomal DNA present in the nucleus is needed to be duplicated and the process that involves the duplication of this chromosomal DNA is known as replication of chromosome which takes place during the interphase of the cell division.

All other processes mentioned in the options are not involved or directly not involved in the processes. Translation involves the mRNA in the cytoplasm to produce amino acids with the help of ribosomes. Cellular respiration involves mitochondria and does not require DNA in the process.

Clams that are native to China are living in the San Francisco bay. How can these clams damage the bay ecosystem?​

Answers

Answer:

Marine Invasive Species are animals or algae that have been translocated from their native region to California marine and estuarine waters. Invasive species are also called introduced, exotic, alien, nonindigenous or non-native.The introduction of NIS can cause harm to the ecosystem by displacing native species, becoming a human health dangerby introducing new diseases, or cause economic havoc on commercial, agricultural, or recreational activities by clogging waterways, and impacting navigation and recreation.

A prime example of the harm an invasive species can cause is Caulerpa taxifolia, also known as Killer Algae, a strain of green seaweed believed to be released from an aquarium directly into a water body or through a storm drain. The Killer Algae forms a dense carpet on any surface including rock, sand, and mud displacing native plants and animals, disrupts the natural food chain, and seriously impacting recreational and commercial fisheries.

Although Caulerpa was successfully eradicated from California marine waters, few eradications have been attempted due to perceived challenges and high cost (over $7M was expended in the case of Caulerpa).

Number of Invasive Species Statewide

The map below shows that all major harbor areas and Bays in California have received significant NIS introductions. San Francisco Bay has the highest number of non-native species, followed by the Ports of Los Angeles/Long Beach. San Francisco Bay is a hotspot for invasions because it has high recreational boating and commercial shipping traffic, a history of oyster culture, and is adjacent to a highly urbanized area. Our research found that San Francisco Bay is a hub for the spread of NIS to the rest of the West Coast.

Explanation:

Question and Answer options in photo.

Zoom in if needed
Help :(

Answers

Answer:

I belive that the answer is B

Explanation:

I believe that it's B because if the rabit population continued to grow then it will allow the soil to become more fuirtle because of the dropings that the rabbits leave behind. This would cause more plants and growth in the habitat, which would lead to economic growth

I hope this helps!

My bird recently flew into a window and in bleeding between his nostrils. The wound keeps bleeding, and we can't afford a Vet visit right now, what should I do?

Answers

Answer:

he finna die

Explanation:

Answer:

OMG are the wings okay

wrap the bird up in an bandage cloth if you have any!

Explanation:

Owls and hawks are both predators, but hawks hunt during the day and owls hunt at night. This reduces ____________________.

A. predation

B. adaptation

C. mutualism

D. competition

Answers

Answer: D. competition

Predators compete with each other in order to achieve prey for food. Since owl hunt at night and hawks hunt in the morning, there is a way unlikely chance they would encounter one another to fight for food.

alaltion
(6) biridity
Inheritance
d) resemblance
2. The tendency of offspring to differ from parents is calle

Answers

2. The tendency of offspring to differ from parents is called inheritance

hope my ans helps

be sure to follow me

stay safe

have a good day

Why might you always need to have some glucose in the blood?

Answers

Answer:

Blood glucose is a sugar that the bloodstream carries to all cells in the body to supply energy. A person needs to keep blood sugar levels within a safe range to reduce the risk of diabetes and heart disease.

Hope this helps :)

Answer:

you need a lot of starch

Explanation:

for your glucode

Other Questions
decide if the two statements are logically equivalent statements, negations or neither pasar esta frase a activa:la joven escocesa ha sido nombrada actriz revelacion del certamen what contributions did Genghis Khan make Find y.Round to the nearest tenth:270350 fty = [? ]ft abrir es aguda llana o esdrujula Describe the empire during Darius rain? Ill give the brainliest What will happen to buildings, statues and canyons where water flows through them over many years? Using the slope formula, what is the slope of the following orders pairs? (6,4) and (15,10) HELPPPPPP I NEED THIS DONE BY TODAY!!!! Which of these best describes the FederalReserve System?-It is an independent agency thatsupervises and manages the financialsystem.-It is an agency through which Congresssupervises and manages the financialsystem.-It is an agency through which the judiciarysupervises and manages the financialsystem.-It is an agency through which theexecutive branch supervises and managesthe financial system. zNote: Figure is not drawn to scale,If x = 4 units, y = 17 units, and z = 3 units, then what is the surface area of the rectangular prism shown above?OA.131 unitsOB. 330 unitsC.204 unitsD262 units2 PLEASE HELP ME!! question below Which of these reasons was NOT a basis for the Antifederalists' opposition to the new constitution? You preform a business service for which you charge $575. You receive $200 in cash and a promissory note for the balance, payable in 60 days. What steps will you use to show this transaction on your balance sheet? How is the chemical bonding between atoms of magnesium different from the chemical bonding within a crystal of aluminum iodide? You have 28 meters of fencing to make a rectangular garden.What different size rectangular gardens could you make with this fencing A six-sided fair mmber cube is rolled once. What is the probability that the result is a 2 or a 5?Write answer as fraction in its simplest form. What is 3x3x3x3x3x3x3x33x3x3x3x3x3x3x3x3x3x3x3x3x3x3x3x33x3x33x3x3x3x3x3x3x3x3x33x3x3x3333333x333x3x3x3x3x3x3x3x3 Check Out!A. Listen to the piece "Solfeggietto" by Carl Philipp Emanuel Bach. Identify the tempo anddynamics used in the piece. Analyze how the music was interpreted and performed.B. Match the tempo in Column A with their meaning in Column B. Write the letters only.AB1. Accelerando a. slow but not as slow as Largo2. Prestob. very slow3. Adagioc. to return to the original speed4. Moderatod. gradually becoming slowe. gradually becoming fast5. Lento6. A tempof. slow7. Ritardandog. fast and lively8. Andanteh. a little faster9. Allegroi. very fast10. Vivacej. fast, lively, and brightk. at a moderate speed GIVING BRAINLIEST!!!!!!!PLS HELPPPP :((Your lungs take in air through the mouth and nose. Explain how the lungs function in the human body.A) They coordinate the movement of the heart.B) They pass oxygen from the air into the blood.C) They pump the blood throughout the body.D) They remove carbon dioxide from the air.