description of human trafficking from 2016 to 2019 in communities ​

Answers

Answer 1
Human trafficking has shown a record-high number of cases during the year 2016.the number number of cases recorded in 2016 had jumped to over 25,000

Related Questions

Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction

Answers

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

Which of the following is not a true statement of the lungs?

Answers

Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.

The lung houses structures of both the conducting and respiratory zones.

The left lung consists of three lobes.

The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters

Explanation:

During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *

erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits

Answers

Answer:

1) erodes

2)deposits

Explanation:

The quickest rate at which a population can grow is its ___________________________.

Answers

I believe it is its reproduction rate

why are earth and moon roughly the same age as the rest of the solar system ?

Answers

Answer:

Our solar system and everything in it was created at roughly the same time.

Explanation:

The Big Bang theory

The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.

Why is there no change in the moon's surface for billions of years?

Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.

How was the Earth and moon formed?

The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.

Learn more about solar system here

https://brainly.com/question/1286910

#SPJ2

Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions

Answers

Answer:

Explanation:

1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP

For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.

The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.

While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.

Refer to the chart in Figure 10: Effects of Surface Gravity, to see what someone would weigh on different planets.


If you weighed 100 pounds on Earth, you would weigh _______ pounds on Saturn.

94.8

91.6

88.4

120.5
pleas help !!!

Answers

You would weigh 108 pounds

Is there anything we as a society can do to prevent these pandemic from occurring

Answers

The only thing you can do now is to try do the necessary pre-causion, which are;

Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancing

Fat cells are expandable. How does this structure relate to a fat cell's function?

A) Fat cells store energy for the body to use later, so being
expandable would help with storage.

B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.

C) Fall cells protect organs, so being expandable can help with cushioning.

D) Fat cells do not expand

Answers

Answer:

Explanation:

d

please help me with this ​

Answers

Answer : B) A population of wolves was introduced into Yellowstone National Park.

This is the only reasonable answer that would explain the decrease of deer, as the wolves would hunt on the deer.

How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?

Answers

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant

Answers

Answer:

The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9

hope it helps

Los autosomas son aquellos cromosomas que se caracterizan por

Answers

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Answers

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants

Answers

Answer:

In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.

Which of the following describes the products of mitosis?


two unique cells

one cell identical to the parent

cell death

two daughter cells that have identical DNA to the parent

Answers

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

Name the main hormone that causes the tropic response movement of pollen tubes towards ovule. ​

Answers

Answer:

Chemotropism

Explanation:

Which is NOT a passive transport mechanism across the membrane of a plant cell?


Which is NOT a passive transport mechanism across the membrane of a plant cell?

Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis

Answers

Answer:

the company has also announced plans

How does water help drive the rock cycle?

A. It is abundant on Earth's surface.

B. It is an agent of weathering and erosion.

C. It helps Earth maintain a relatively constant temperature.

D. It maintains a liquid state in a relatively narrow range of temperatures

ap3x​

Answers

The correct answer is D

an example of is a leaking gasoline. tank​

Answers

Answer:

When this happens, gas may leak from the vehicle, having an effect on fuel economy, and potentially leading to a dangerous fire or explosion. If gasoline is leaking from the gas tank, you should be able to notice the leak underneath the rear of the vehicle accompanied by a noticeable smell.So that obviously has tank or cylinder is a leaking gasoline.

Explanation:

mark me as brainliest if it helped you >•<

Differences among individuals of the same species are known as:
Different offsprings, from the same parents.
A.Natural Selection
B.Adaptations
C.Variations
D.Fittness

Answers

Answer:

variation is the answer that is genetic variation

I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural

Answers

What are the answer choices

ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution

Answers

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:

a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over

Answers

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?

2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?


3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?




4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?





5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.



6. Is this microbe normal microbiota at the culture site?




7. What type of treatment would be used for this patient

Answers

Answer:

All the answers are there in the photo

Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?

1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium

Answers

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?

Answers

Answer:

True

Explanation:

Because for each death someone is born

It's like 1+1+1-1-1=1

The answer is the same

What is flight initiation distance FID

Answers

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3

Which two key stellar properties determine all
the other stellar properties?

Answers

Answer:

way of seeling and product that he/ she is seeling

Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary

Answers

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

m is the mass of the object.g is the acceleration due to gravity.

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

Other Questions
What do x and y equal? Which question is most clearly analytical in nature?A.Who could be interviewed to share his or her insight about the story?B.When was the first edition published?C.What is the history of authors childhood D.How does a characters internal conflict affect the tension a story? Think about your teachers, supervisors and other adults whoknow you well. Is there anyone who thinks highly of you whomight write you a recommendation? Find the measure of each angle listed below. Enter only numbers without space. (1) PTQ(2) QTR(3) PTS please answer asap (look at picture) please answer both PLEASE HELPPPP!!!!!!!!!!!!!!!!!!!! Despite his insecurities, Czar Nicholas ofRussia believedA. That he could make Russia great againB. That he could restore the Russian empireC. In his divine right to ruleD. That he could eventually rule the world Each pair of figures is similar find the missing side I need this fast please Please help asap, this is timed!!!!!!I'll mark brainliest! how can the laws of human trafficking protect citizens in south africa The solution to this system of equations lies between the x-values -2 and -1.5. At which x-value are the two equations approximately equal? y = 1 / x + 2 y = x^2 + 2 chron = "time"geo = "earth"graph = "writemeter = "measure"Which word most likely means "a timepiece fitted with a recording device that marks down exact intervals of time"?chronographchronometergeographicgeometric 6;10;14find the next two terms of the sequence Due in 50 mins Please help). Writing Assignment: Analysis of Fat intake. Create a journal of your fat intake. In your analysid, answer the following questions: 1) How many total grams of fat did you consume? 2) How much saturated, unsaturated and trans - fat did Iyou consume? 3) Was your fat intake during these two days in a healthy range? Too much? Too little? 4) Did you eat the wrong type of fat? 5) Can you do better? If so, how can You change your eating habits to improve? ( Will Mark Brainliest if answered correctly). Can you write out one for you to show me how it needs to be done just for an example please. WILL GIVE BRAINLIESTWrite the correct yo form of each verbComplete each sentence with the correct form of the verb in parenthesesAnswer yes to the following questions. Follow the model. What kind of fossil is a wooly mammoth found frozen in arctic ice?a.Cast fossil b.Mold fossil c.Preserved fossil d.Trace fossil (pls help im suffering) 3.06a Finding Standard Form by Completing the SquareClassify each as Circle, Quadratic (parabola) or other(x - 5)2 + (v - 2) = 16= 10022 - x = 25(x - 2) - (y + 5)= 10y = 2x + 5 Qu nombre reciben las slabas de dos pa-labras diferentes que se juntan para formaruna sola slaba en un verso? Which sentence integrates a quotation effectively? When knowledge is democratized, it means that:O A. people decide what information is important to release to thepublic.B. people have equal access to information and can contribute tothat information as well.C. everyone can vote to decide what knowledge is shared.D. everyone has a right to own and use electronic devices andcomputers.