Answer:
By making things able to be recycled more often, people are creating biodegradable plastic products which break down much quicker compared to regular plastics that will last longer than our lifetime, reusing plastics is basically recycling but actually making it into a whole other product in order to prevent that plastic from going to yet another landfill, I can't think of anything else right now but I hope this helps
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
Refer to the chart in Figure 10: Effects of Surface Gravity, to see what someone would weigh on different planets.
If you weighed 100 pounds on Earth, you would weigh _______ pounds on Saturn.
94.8
91.6
88.4
120.5
pleas help !!!
The incidence of spinal muscular atrophy (an autosomal recessive disease) in the United States is about 1 case in every 17,000. Whereas, in North Dakota, the prevalence is 1 in 6720. Which of the following would support the hypothesis that genetic drift was responsible for the increased allele frequency in North Dakota?
A. There is an abnormally high concentration of mutagenic chemicals in the ground water causing an increased mutation rate in North Dakota.
B. One of the best treatment centers for SMA is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency
C. The original settlers of North Dakota were a small group of pioneers who happened to have an abnormally high frequency of the SMA allele in their population.
D. A particular mosquito-born parasite native to North Dakota causes high infant mortality; carriers of the SMA allele are less likely to catch the disease.
Answer:
check this out
Explanation:
A paragraph is a series of related sentences developing a central idea, called the topic. Try to think about paragraphs in terms of thematic unity: a paragraph is a sentence or a group of sentences that supports one central, unified idea.
Genetic drift says it is a random selection of a genetic variant that causing a change in allele frequency in a population.
One of the best treatment centers for Spinal Muscular Atrophy is located in North Dakota causing migration of SMA carriers into the area at an abnormally high frequency. Thus option B is correct.
What is spinal muscular atrophy?It is a group of autosomal recessive inherited disorders cause progressive muscle degeneration and weakness. One of the second leading neuromuscular disease.
Three types of SMA affect only children of less than 1 year and , type IV and Finkel type observed in adult, Symptoms in adult include weakness in muscles, tremor etc.
Type 1 SMA seen during birth symptoms include difficulty breathing and swallowing, Type II show muscle weakness between ages 6 and 12 months, Type III is juvenile type unable to stand and walk.
Type IV causes muscle weakness, tremor and twitching.
Learn more about muscular atrophy, here:
https://brainly.com/question/12993167
#SPJ2
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
Help me with this ASAP please I will mark you with Brainliest
please help me with this
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction
Answer:
1) GPP is the energy spent staying alive
Explanation:
Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.
Whah are the types of kidney?
Answer:
Distinct cell types include: Kidney glomerulus parietal cell. Kidney glomerulus podocyte. Kidney proximal tubule brush border cell.
System: Urinary system and endocrine system
Nerve: Renal plexus
Artery: Renal artery
Vein: Renal vein
Answer:
There are no different types of kidney. We've 2 kidneys - left kidney & right kidney.
The left kidney is longer and narrower than the right kidney. This kidney is in the direction facing the right kidney.Also the left renal volume appears approximately 146 [tex]cm^{3}[/tex] in shape, whereas the right one measures around 134Hope it helps!
╭═══════ღ❦ღ══╮
[tex]RainbowSalt^{2222}[/tex]
╰══ღ❦ღ═══════╯
Which two key stellar properties determine all
the other stellar properties?
Answer:
way of seeling and product that he/ she is seeling
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
Basketball in across a flat floor has blank energy
Answer:
Potential energy. If its laying on a flat floor and not moving, it has the potential to move. if its rolling it has kentic energy bc it wouldnt have the potential, it would be moving. I hope this helps and good luck :)
Explanation:
Fat cells are expandable. How does this structure relate to a fat cell's function?
A) Fat cells store energy for the body to use later, so being
expandable would help with storage.
B) Fat cells burn energy quickly when other food source is available, so being expandable would help with the rapid burn.
C) Fall cells protect organs, so being expandable can help with cushioning.
D) Fat cells do not expand
Answer:
Explanation:
d
Which of the following is NOT true of fungi?
Select one:
a.
They digest their food outside of the body
b.
They recycle inorganic nutrients to photosynthesizers
c.
Each of the filaments on the body is a mycelium
d.
Fungi cells lack chloroplasts
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
A mother is feeding her infant a cultural dish that contains honey. How do you manage this situation in a culturally sensitive way while considering the safety of her infant?
The situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration. This is because it is a matter of the safety of an infant.
What are the steps required for the safety of infants?The steps required for the safety of infants are as follows:
Make a small diet plan for the infant.Do not leave your infant alone on the table, sofa, chair, etc. Always put your baby in a safe place when you are not able to hold him properly.Always follow systematic orders for vaccination.Ensure your child is hydrated all the time.Make possible events to prevent the entry of pathogens.In this situation, you have to acknowledge to the mother that this practice is not safe for the health of your infant and try to introduce some of the negative aspects of this action. Also, warn her not to proceed with this action in the future because child safety is of utmost importance.
Therefore, the situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration.
To learn more about the Safety of infants, refer to the link:
https://brainly.com/question/28103752
#SPJ2
Los autosomas son aquellos cromosomas que se caracterizan por
Answer:
Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.
Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).
This is the type of succession that
occurs when all of the usable soil
has been destroyed in an
ecosystem.
A seccession
B primary
C Secondary
C. Secondary Succession
The process of an ecosystem returning to its stable form after a disaster is known as secondary succession.
This happens faster than primary succession because the soil is already formed and nutrients are more available at the beginning of the process.
Hope it helps you! ＼(^ᴥ^)／
Secondary is the type of succession that occurs when all of the usable soil has been destroyed in an ecosystem.
What is a succession?Succession is the process of change and development that occurs in an ecosystem over time. It refers to the gradual replacement of one community of plants and animals with another, as each community modifies the physical and biological environment in which it lives. There are two main types of succession: primary succession and secondary succession.
Primary succession occurs in an ecosystem that has no soil or vegetation, such as on newly formed volcanic islands or in areas where glaciers have retreated. During primary succession, the ecosystem must develop from scratch, with the creation of new soil and the establishment of new plant and animal communities. This process can take a significant amount of time.
Secondary succession occurs when all of the usable soil has been destroyed in an ecosystem. This type of succession can occur after a natural disaster, such as a fire or a flood, or after human activity, such as logging or farming. During secondary succession, the ecosystem must rebuild itself from scratch, with new soil being created and new plant and animal communities establishing themselves. This process can also take a significant amount of time, depending on the severity of the disturbance and the conditions of the ecosystem.
Learn more about succession, here:
https://brainly.com/question/26675203
#SPJ2
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3
Ella has a mass of 56 kg, and Tyrone has a mass of 68 kg. Ella is standing at the top of a skateboard ramp that is 1.5 meters tall. Which conclusion is best supported by the given information?
If Tyrone stands at the top of the same ramp, his potential energy will be less than Ella’s.
If Tyrone stands at the top of a 1 m high ramp, his potential energy will be greater than Ella’s.
If Tyrone stands at the top of the same ramp, his potential energy will be the same as Ella’s.
If Tyrone stands at the top of a 2 m high ramp, his potential energy will be greater than Ella’s.
Answer:
d i guess
Explanation:
why are earth and moon roughly the same age as the rest of the solar system ?
Answer:
Our solar system and everything in it was created at roughly the same time.
Explanation:
The Big Bang theory
The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.
Why is there no change in the moon's surface for billions of years?Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.
How was the Earth and moon formed?The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.
Learn more about solar system here
https://brainly.com/question/1286910
#SPJ2
A forest fire destroys an area. A small population of trees and a large population of birds are both affected. Which type
of limiting factor causes this?
density dependent
density independent
population dependent
population independent
Answer:
B. DENSITY INDEPENDENT
Explanation:
Density independent is a limiting factor. It affect birth and death rates of organisms through abiotic and environmental factors. A forest fire is one of the environmental factors that affects the density of a species in a given location.
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
The quickest rate at which a population can grow is its ___________________________.
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
Which is a positive effect of wildfires?
Answer: it lets for room for more buildings to be built
Explanation:
Base your answer to questions 8 and 9 on the diagram below and on your knowledge of
biology
The diagram represents a portion of a starch molecule.
8. The energy in this molecule is stored
1. in the bonds between atoms
2. when the carbon atoms break off
3. in the oxygen found in the molecule
4. when water breaks this molecule apart
9. The building blocks for this molecule are
1. amino acid
bases
2. simple sugars
3. Fats
4. molecular
In a starch molecule, the energy is stored in the bonds between atoms, and the building blocks of this molecule are simple sugars.
Starch is a carbohydrate and a polysaccharide, this means this molecule is composed of dozens of glucose molecules that have formed a chain and it is used by organisms, especially plants to store energy.
In other words, starch is the result of glucose molecules forming a chain, and glucose is considered a simple sugar. Therefore, starch is made up of simple sugars.
On the other hand, the energy in starch can be found in the bonds between atoms. This implies once the bonds between atoms break energy is released, and this energy is used by organisms for multiple activities.
Learn more about molecule in: https://brainly.com/question/19922822