Answer:poop
Explanation:
yuh poop
Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue
imagine a population of squirrels in which the squirrels are a range of sizes.
how can this type of diversity affect the population?
A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.
Answer:
C. Recycling increases the supply of wood
In what part of the plant are substances transported to where they are needed?
A. Roots
B. Stem
C. Leaves
Answer:
B. Stem.
hope it helps
stay safe healthy and happy.Answer:
B. Stem
Explanation:
In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.
Which of the following terms describe the Fungi?
-symbionts
-parasites
-predators
-saprobes
Answer:
saprophytesExplanation:
saprophtes not saprobes describe the fungi because they feed on dead organisms.
I hope this helps you
:-)
What is likely to happen to a healthy population that is experiencing exponential growth ?
A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.
Answer:
.
Explanation:
............................
The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
What is Canyon landscape?A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.
Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.
Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.
Learn more about Canyon landscape, here:
https://brainly.com/question/22035152
#SPJ2
Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food
what do you mean by faunal Diversity
Answer:
animal life especially
Explanation:
i hope it helps
this is my answer
correct me if im wrong
#carryonlearning
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide
B. oxygen
C. Water
D. Glucose (sugar)
Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XDAnyway the answer to your question is:
Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct((-Side Note-)): glad i could help lol
I hope you have a great day ^v^"reproductive system brain pop Worksheet
Help please?
Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?
Answer:
don't known ask the goggle
What is the purpose of the heart in the circulatory system?
Select one:
It provides oxygen during the release of hormones.
It is the muscle the pumps blood around the body.
It prevents pathogens from invading the organism.
It controls all of the body's functions.
Answer:
It is the muscle that pumps blood around the body
Explanation:
Four friends were talking about the food they ate. Here is what they were discussing. • Kaustubh: ' It gives us energy to walk, run and lift things." • Shailaja: "It becomes a part of our body." • Jayasree: "It helps to fight diseases." • Aarti: "It is needed for the functioning of organs like the heart, brain and lungs." Who is correct?
IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE
What is the main function of the endocrine system?
A. secrete hormones
B. send nerve impulses
C. produce blood cells
D. produce DNA
Answer:
I think the answer to your question is option A , secrete hormones
helppppppp plzzzzzzzzzzzzzzzzz
Answer:
A
Explanation:
Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja
When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems
Answer:
1
Explanation:
they can never be mixed
Describe how people get energy from oil nonrenewable
Answer:
Oil can be burned to heat water, using the steam to generate power. Or, oil can be burned under pressure to produce exhaust gasses.
what is sustainable development?
what is environmental conservation?
Give short answer
Answer:
The long term development which is done by the preservation ,utilization and management of resources which is used by present generation and with preservation for future generation is sustainable development.
the conservation of habitat of living beings and plants is called environment conservation.
What controls traits and inheritance?
gametes
nucleic acids
proteins
temperature
Answer:
B.
Explanation:
the answer is nucleic acid
Answer: B
Explanation:
Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3
Answer and Explanation:
La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.
Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.
El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.
ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3
Codones ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT
ARNm ⇒ UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA
Codones UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.
Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.
AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU
La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.
UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA
TYR SER TRP VAL Stop THR ARG ILE ARG PHE PHE Stop
The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?
Answer: Because they cause a disturbed ecosystems.
Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.
Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.
Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?
What nervous system is controlled by the hypothalamus?
Answer:
The hypothalamus is the key brain site for central control of the autonomic nervous system, and the paraventricular nucleus is the key hypothalamic site for this control.
Explanation:
The number of small tree finches is increasing on an island inhabited by a large population of small ground finches. State one reason why the population of small ground finches has not been affected by the increasing number of small tree finches.
Answer:
yes
Explanation:
Choose three things that blood transports throughout the body.
Nerve impulses
French fries
DNA
nutrients
wastes such as CO2
oxygen
Answer:
nutrientswastes such as CO2oxygenExplanation:
Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.
The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).
1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.
2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.
3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.
Learn more about Blood, here:
https://brainly.com/question/32316698
#SPJ6
Describe a genetic disorder caused by a mutation in a single gene
Answer: Tay-Sachs a disease caused by an absence of an enzyme that break down fatty substance causing damaged to nerve cells
IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS
A teacher is demonstrating that the boiling point of water does not change with water volume.
Which of these should the teacher perform to support this hypothesis?
A. Heat equal volumes of 10°C and 20°C water for 15 minutes each.
B. Heat equal volumes of water for 10 and 20 minutes and record any change in the volumes.
C. Heat 100 mL and 300 mL of water and record the temperature when boiling occurs.
D. Heat 150 g and 100 g of water until the containers are completely dry.
Answer:was the answer
Explanation: