choose equation that will be used to solve this problem
Hugo sold blank tattoos

Choose Equation That Will Be Used To Solve This ProblemHugo Sold Blank Tattoos

Answers

Answer 1

Answer:

It looks like the equataion is 2x(hugo)-10+y=137

Step-by-step explanation:

Hugo sold twice as many as italia but fewer 10.


Related Questions

La suma de dos números enteros que tienen signos diferentes es:

Answers

1 Si los sumandos son del mismo signo, se suman los valores absolutos y al resultado se le pone el signo común. 2 Si los sumandos son de distinto signo, se restan los valores absolutos (al mayor le restamos el menor) y al resultado se le pone el signo del número de mayor valor absoluto.

Answer:

Hhhhhhhhnnnnnnnnnn

Step-by-step explanation:

Bbb

mathematic uh coordinate planes ty and brainlist for the first person to answerr it right

Answers

Answer:

Me puedes informar mas?

Step-by-step explanation:

plzzzzzzzzzzzzzzzzzzzzzzzzz help

Answers

Answer:1. C2. x = 83. A4. A (I and III)

Hope this helps!! ♥︎

Two of the sides of a triangle are 7 inches
and 8 inches. If the third side is a whole
number of inches, what is its greatest
possible measure?

Answers

Answer:

11 inches

Step-by-step explanation:

7^2+8^2=c^2

49+64=c^2

113=c^2

square root both side

c=10.63014581

round up and get c=11

hope this helped :)

What is the equation of the line that passes through the points (15,9) and (-2, 9)?
Oy - 9
11
Oy ----x+ 9
Oy=-17
Oy - 6x + 11

Answers

Answer:

c

Step-by-step explanation:

A package of sliced cheese weighs 2 1/4 pounds and costs $18. If 3 slices weigh a total of 2 ounces, how much do the 3 slices cost?

Answers

10 slices will cost 10 dollars

14 - 2(11 - 5) + [tex]7^{2}[/tex]=

Answers

Answer:

51

Step-by-step explanation:

Isaac received 125 for his birthday. He spent 65 on a new video game. How much money, x, how much does issac have

Answers

Answer: $60

Step-by-step explanation:

Which equation represents a circle that contains the point (-5, 3) and has a center at (-2, 1)? Distance formula: vaa -02 (x - 1)2 + ( + 2)2 = 25 (x + 2)2 + (-1)=5 O (* + 2) + (-1) - 25 (x-1) + ( + 2) = 5

Answers

Given:

The center of the circle = (-2,1).

Circle passes through the point (-5,3).

To find:

The equation of the circle.

Solution:

Radius is the distance between the center of the circle and any point on the circle. So, radius of the circle is the distance between the points (-2,1) and (-5,3).

[tex]Distance=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

[tex]r=\sqrt{(-5-(-2))^2+(3-1)^2}[/tex]

[tex]r=\sqrt{(-5+2)^2+(2)^2}[/tex]

[tex]r=\sqrt{(-3)^2+(2)^2}[/tex]

On further simplification, we get

[tex]r=\sqrt{9+4}[/tex]

[tex]r=\sqrt{13}[/tex]

The standard form of a circle is:

[tex](x-h)^2+(y-k)^2=r^2[/tex]

Where, (h,k) is the center of the circle and r is the radius of the circle.

Substitute h=-2, k=1 and [tex]r=\sqrt{13}[/tex].

[tex](x-(-2))^2+(y-1)^2=(\sqrt{13})^2[/tex]

[tex](x+2)^2+(y-1)^2=13[/tex]

Therefore, the equation of the circle is [tex](x+2)^2+(y-1)^2=13[/tex].

30% of what number is 7.5?

Answers

Answer should be 2.25

Find the area. The figure is not drawn to scale.

Answers

Answer:

A = 1/2 (13) ( 9 +9)

A = 1/2 (13) (18)

A = 117

Will give brainiest to correct answer with explanation

1. on Thursday, John drove 3x - 6 miles. On Friday, he drove 2x - 8 miles. What is
the difference in miles driven?

Answers

Answer:

The answer is 1x+(-14)

Step-by-step explanation:

Step 1: Write the expression(3x-6)-(2x-8)

Step 2: Do KCC to the whole expression (keep change change)

(3x-6)+(-2x+-8)

Step 3: Rewrite with the like terms together.

(-2x+3x)+(-6+-8)

Step 4: Combine the like terms

1x+(-14)

Tell whether each pair of angle measurements are complementary, supplementary or neither.  36°,24°  18°,72°  96°,84°

Answers

Given:

The pairs of angles are:

36°,24°

18°,72°

96°,84°

To find:

Whether each pair of angle measurements are complementary, supplementary or neither.

Solution:

Two angles are complementary if there sum is 90 degrees.

Two angles are supplementary if there sum is 180 degrees.

For 36° and 24°,

[tex]36^\circ+24^\circ =60^\circ[/tex]

So, this pair is neither complementary not supplementary.

For 18° and 72°,

[tex]18^\circ+72^\circ =90^\circ[/tex]

So, this pair is complementary.

For 96° and 84°,

[tex]96^\circ+84^\circ =180^\circ[/tex]

So, this pair is supplementary.

⚠️THIS IS DUE TODAY⚠️ USE DISTRIBUTIVE PROPERTY

Answers

Answer:

4x + 8

-45 - 5x

7x - 21

Step-by-step explanation:

For the first one

4(x + 2)

for distributive property you multiply the number or symbol next to the outside of the parenthesis, by everything inside the parenthesis.

4(x+2)

4*x = 4x

4*2 = 8

So, this is 4x + 8

-5(9+x)

-5*9= -45

-5*x=-5x

So, this is -45 - 5x

7(x-3)

7*x= 7x

7*-3= -21

This will be 7x - 21

Hope this helps!!

-Ketifa

The opposite sides of a parallelogram are _____?

Answers

Answer:

parallel

Step-by-step explanation:

Answer:

A parallelogram is a quadrilateral

Her why:

whose opposite sides are parallel. The opposite angles of a parallelogram are equal. The opposite sides of a parallelogram are equal.

what is 4/7 + 1/8 in math

Answers

correct answer is 39/56

A scale drawing has a scale of 2 cm = 15 m. If the length of something on the drawing is 12 cm, what is the actual length?

Answers

Answer: 90

Step-by-step explanation:

Answer:

90m

Step-by-step explanation:

you have to cross multiply.

1) multiply (12 * 15) and multiply 2 * X)

2) you get 180 = 2x

3) to get X alone divide 180 by 2 and you will get 90meters

Felipe calculated that he uses about 545 gallons of fuel each year. His car's owner's manual says that it is approved to use regular fuel. How much money can he save each year by switching from premium fuel, at $4.59 per gallon, to regular fuel at $4.18 per gallon?

$0.41

$2,501.55

$223.45

$2,278.10

$4,779.65

Answers

Answer:

$223.45

Step-by-step explanation:

premium fuel: 4.59 x 545

= 2501.55

regular fuel: 4.18 x 545

=2278.1

2501.55-2278.1 = 223.45

A golf course has 18 holes. A guidebook provided to golfers includes useful information about each hole, as shown below. A 4-column table with 6 rows. Column 1 is labeled hole number with entries 1, 2, 3, 4, 5, 6. Column 2 is labeled yards with entries 312, 530, 147, 350, 410, 185. Column 3 is labeled bunkers with entries 2, 5, 1, 0, 2, 1. Column 4 is labeled difficulty level with entries moderate, moderate, easy, moderate, hard, moderate. What are the individuals in this data set? holes yards bunkers difficulty levels

Answers

Answer:

Holes got it right :)

Step-by-step explanation:

Answer

difficulty levels

Step-by-step explanation:

took the test

sorry different question

PLEASEEEEEEEE HELPPPPPPP

Answers

It would be the 4th one

Solve for x.parallelogram
Plz show steps so I can learn

Answers

Answer:

in a parallelogram .......the sum.of adjacent angles is 180

11x-10+80=180

11x=110

x=10

Solve these simultaneous equations:
6x + 8y = 36 6x + 5y = 27

Answers

Answer:

Y = 3

X = 2

Step-by-step explanation:

(6x2) = 12

(8x3) = 24

12 + 24 = 36

(6x2) = 12

(5x3) = 15

12 + 15 = 27

if PQ and PR are tangent to circle S,find PQ

Answers

Answer:

From one point, you can draw two tangents to a circle. These two tangents will be equal.

Step-by-step explanation:

7x - 24 = 57 - 2x.

Rearrange the numbers (by adding 2x and 24 on both sides), we get:

7x+2x = 57 + 24

9x = 81.

x = 9.

Length of PQ = 57-2x = 57 - 18 = 39

If PQ and PR are tangent to circle S, then the value of PQ is 39.

What is tangent?

"A line that touches the circle at a single point is known as a tangent to a circle."

What is circle?

"A circle is a shape consisting of all points in a plane that are at a given distance from a given point, the centre."

P is the exterior point of a circle.

PQ and PR are the tangents to circle S.

According to theorem,

The lengths of the tangents drawn from a same external point to a circle are always equal.

7x - 24 = 57 - 2x

7x + 2x = 57 + 24

9x = 81

x = 9

PQ = 7x - 24

PQ = 7(9) - 24

PQ = 63 - 24

PQ = 39

Hence, the value of PQ is 39.

To learn more about tangent of a circle here

https://brainly.com/question/23265136

#SPJ2

A television channel broadcasts a baseball game every day. Yesterday's broadcast showed the game for 2 5/6 hours and commercials for 2/3 hour. At this rate, how many hours does the television channel show a game for every hour it shows commercials during its broadcasts?

Answers

Answer:

4.25 hours

Step-by-step explanation:

Given that :

Game broadcast time = 2 5/6 hours = 17/6 hours

Commercials time = 2/3 hours

2/3 hours of commercials = 17/6 of game broadcast

1 hour of commercials = x hours of game broadcast

Cross multiply ;

(2/3)x = 17/6

2x * 6 = 17 * 3

12x = 51

x = 51 / 12

x = 4.25

For every hour it shows commercials, game is broadcasted for 4.25 hours

Hollis goes outside at 2:00. He spends 48 minutes riding his bike and playing with his dog. What time is it now? Write the time in two ways.

Answers

Answer:

2:48

Step-by-step explanation:

48 minutes passed and he went outside at 2:00 im not sure what they mean by write it in 2 ways though

A fun park charges $10 for admission and then two dollars for every ride. Write a function that determines the amount of money spent, Y, based on the number of rides ridden, X.!! please help ahhh

Answers

Answer:

x is I think 5

Step-by-step explanation:

dndjdudjndndjdjdjjd

May someone please help me with this :)

Answers

so to find the answer you would use the formally 1/2bh
1/2(3.5)(1.5)
which give you 2.625

Use substitution to solve the following system of equations.
x + 2y = 13
3x - 5y = 6

Answers

Answer:

{1} x + 2y = 13

{2} 3x - 5y = 6

x = 13 - 2y

substituting into {2}

3x -5y = 6

3( 13 - 2y) - 5y = 6

39 - 6y -5y = 6

-11y = 6 -39

y = -33 /-11

 ( minus and minus cuts in fraction, so the answer will come in positive)

y = 3

now , substituting into {1}

x + 2(3) = 13

x = 13 -6

x = 7

so,

the solution are:-

x = 7

y = 3

I hope this helps a little bit.

At practice, Diego does twice as many push-ups as Noah, and also 40 jumping
jacks. He does
62 exercises in total. The equation 2x + 40 =62 describes this situation. What does
the
variable represent?

Answers

Answer:

1980

Step-by-step explanation:

5x4*x9=1980

Hope this helps :)

Brainliest?

。◕‿‿◕。 ITS PICKACHU  DAY

Use the long division method to find the result when 4x^3+18x^2+22x+54x 3 +18x 2 +22x+5 is divided by 2x+52x+5.

Answers

Answer:

2x² + 4x + 1

Step-by-step explanation:

Given the question :

4x^3+18x^2+22x+5 divided by 2x+ 5

Dividend = 4x^3+18x^2+22x+5

Divisor = 2x + 5

In other to ensure question is answered clearly and reasonably, the solution Using long division haa been worked out and attached as a picture

Other Questions
Which passage best explains how the focus of passage 1 differs from the focus of passage 2 How did the development of capitalism impact workers?A. It established workers as controllers of the means of productionB. It began a system of apprenticeship C. It began a system of wage laborD. It began a system of profit sharing what is the power times a power where does the power go in a equationhow do you put a power in a equation Factor the expression 28x -8 HELP ITS DUE IN AN HOUR!!What is a lattice position?Explain Find each missing measure, please help If a square has an area of 25x, write an expression for the length of one side.:) Which to expressions are equivalent to 3.2 (4p + 8.5)?3.2 (Ap) + 3.2(8.5)7.2p+8.512.8p+ 27.215.7p40p I needddd helpppppppppppooopp urgentttttt will mark brainliest Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA