Based in the myths, what are values of both the Haida and the Māori? Check all that apply

Answers

Answer 1

Answer:

What are the answer choices?

This is what I know about that myth though...hope it helps

Explanation:

Similar to the Haida, the Maori greatly valued nature, family, and love, and used to include in their myths stories that emphasized and show the importance of these elements.

Answer 2

Answer:

The Answer Is: Family , Love , & Nature .

Explanation:


Related Questions

PLEASE HELP ITS DUE TODAY AND I DONT KOW ITS FOR 10PTSS
Making the Most of Mucus
Just the name itself will make you giggle. It's a great word that conjures visions of slime and unpleasantness. It is perhaps the most annoying part of having a cold or allergies. Mucus, however, plays a very important role in defense of our bodies and our health. In fact, it's high time mucus got a lot more respect.

First, there are some amazing facts about mucus that are worthy of respect. Humans produce about a liter of mucus every day, whether they are sick or not. Bony fish and some invertebrates (snails or slugs) also have mucus cells on the outside of their body. This external mucus creates a protective coating that prevents predators' toxins from doing harm. Humans produce mucus to protect our stomachs, our lungs, and several other systems.

We tend to not like mucus because it is a considered a symptom or sign that something is wrong. We usually only see it when we are sick, and so we tend to dislike it. According to Michael M. Johns, III, MD, however, "mucus is incredibly important for our bodies." Johns, an assistant professor at Emory University, calls mucus "the oil in the engine" of our bodies. Without mucus, our engines, or bodies, would freeze up and stop working properly.

Furthermore, mucus is not just the nasty gunk you see when you are sick. It lines the tissues in your mouth, your nose, throat, and lungs. It also is crucial in protecting your digestive system. Mucus puts a protective coating over the surfaces of these tissues, keeping them moist. Most of the time we don't notice mucus is making our lives better. It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Occasionally, though our mucus-making membranes go into overdrive. If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you. If you come into contact with pollen, you may get a runny nose and start sneezing and coughing. When these things happen, your mucus systems start making more fluids to wash away the irritating particles. Mucus also has some antibodies that increase our ability to fight off bacteria and viruses.

It's hard to appreciate what is essentially slime, but we have mucus for some very good reasons. It helps to keep us healthy and lets us know when our bodies are under attack. We would be wise to respect what our bodies do to keep us safe. So the next time you find yourself reaching for a tissue, remember mucus is your friend and ally.

Which line from the text explains people's attitude about mucus? (1 point)

a
If you eat a hot pepper, your mucus membranes in your mouth and throat start producing extra mucus to protect you.
b
Humans produce mucus to protect our stomachs, our lungs, and several other systems.
c
We tend to not like mucus because it is a considered a symptom or sign that something is wrong.
d
It does its job quietly, making everything run smoothly, keeping our inner tissues soft and flexible enough to fight off invaders.

Answers

Answer:

C

Explanation:

It's the only choice that actually expresses an opinion.  Plus, it says it directly in the text.

Hope this helps :)

The answer to this question is d I believe hope you get it right and good luck

Which of the following sentences does not have parallel structure?
Group of answer choices

Both of these.

None of these.

Either I will or I won’t.

I hope to vacation either in Spain or Ireland.

Answers

I think it is the last sentence but I might be wrong

What does King Lear’s question suggest about his personality?

Answers

In spite of his despair and self-pity, Lear is revealed as a complex man, one whose punishment far exceeds his foolish errors, and thus, Lear is deserving of the audience's sympathy. Eventually, Lear displays regret, remorse, empathy, and compassion for the poor, a population that Lear has not noticed before.

Using the sentence context, determine the meaning of the word "copious" in the following example.
Given that Arturo has read more than 23 books about volcanoes, his knowledge about the eruption of Mount
Vesuvius is copious.
abundant
limited
impressive

Answers

The answer is limited.
Copious means to be full or abundant. Arturo has enough knowledge about volcanoes which helps him know more about the mount Vesuvius eruption. Looking at our choices, we can cross limited out. He knows a lot and can go further more if he wanted to, so the answer is abundant.

Click on the verb(s) in the following sentence:
I was happy that she wrote to me.

Answers

Answer:

was and wrote

Explanation:

"I was happy" (LINKING VERB) is telling the reader how she feels and "that she wrote to me" (ACTION VERB) is telling us why she feels that way.

I needhelp with these questions right now​

Answers

Answer:

Sentence 2 repeats sentence 5 is unsorted and I would add more details reasons behind there opinion

sentence 5 states and unsupported opinion because it doesn’t tell why cities are dangerous

Chapter 1: Beliefs and Teach
The following statements are muddled up. Add them in the correct order to the flowchart
below, to retell the story of Creation as described in Genesis chapters 2 and 3.
Adam and Eve lived in a garden full of wonderful trees and plants
They disobeyed God's command and ate from the tree
God told Adam and Eve not to eat from the tree of the knowledge
of good and evil
Adam and Eve became afraid and hid from God
God created the universe including the first humans, Adam and Eve
Adam and Eve had to leave the garden
Adam and Eve were tempted by the snake to eat from the forbidden tree
.

Answers

Answer:

1. God created the universe including the first humans, Adam and Eve

2. Adam and Eve lived in a garden full of wonderful trees and plants

3. God told Adam and Eve not to eat from the tree of the knowledge of good and evil

4. Adam and Eve were tempted by the snake to eat from the forbidden tree

5. They disobeyed God's command and ate from the tree

6. Adam and Eve became afraid and hid from God

7. Adam and Eve had to leave the garden

Which image best supports the claim that community races are a great way to encourage people of all ages to
exercise?

Answers

Answer:

The first picture because is has adults and kids running

Answer:

First picture

Explanation:

Got it right on edg

It this excerpt were made into a movie, which adaptation
would best allow the director to comment on current
politics?
Read the excerpt from Hamlet.
Voltimand:.On Fortinbras; which he, in brief, obeys,
Receives rebuke from Norway, and, in tine,
Makes vow before his uncle never more
To give the assay of arms against your majesty.
Whereon old Norway, overcome with joy,
Gives him three thousand crowns in annual fee,
And his commission to employ those soldiers,
So levied as before, against the Polack;
With an entreaty, herein further shown, [Giving a pper.]
O updating the setting to a modern city
O changing the costumes to modern fashion
O replacing the outdated terms with slang
O using actors with diferent ethnicities

Answers

The adaptation following the director's comment would be:

C). replacing the outdated terms with slang

Director

The director is defined as the individual who directs the characters to perform the scene accordingly and make the author's purpose serve successfully.

The third option most clearly assists the director in communicating the commentary over the recent politics i.e. 'substituting the ancient terms through idioms and jargon.'

Thus, option C is the correct answer.

Learn more about "Hamlet" here:

brainly.com/question/2010722

PLEASE HELP ME ANSWER THIS QUESTION

Which of the topics listed would you most likely be able to research using the library or internet, and would you most likely not be able to research?

Answers

Answer: the internet and library can help with the American revolution and photosynthesis

Answer:

The topics listed would you most likely be able to research using the library or Internet would be "the process of photosynthesis" and "the American Revolution", and those which you would most likely not be able to research are "the number of shoes you own" and "your best friend's favorite childhood memory"

Explanation:

Football and baseball are two of the most popular sports in the country. They are similar in some ways. For one, they are both team sports, and they both require players to advance to an end or “home” point on the playing field. However, football, unlike baseball requires players to carry the ball to the end zone, while in baseball, it is the defending team that controls the ball while it is in play


Cause/ Effect

Chronological


Compare/Contrast

Problem/ Solution

enumeration/ Description

Answers

This passage is described using compare and contrast because it compares football and baseball. :]

HELP PLSSS
What should the body of an essay contain in each paragraph?
A. one topic sentence and three supporting detail sentences
B. four supporting detail sentences about the topic
OC. three topic sentences and one supporting sentence
D two topic sentences and two supporting sentences

Answers

Two topic sentences and two supporting sentences

Answer:

Hi! I think it's A - one topic sentence and 3 supporting



With no where to go sometimes, I have become your best friend. I store all your favorite items in one place.​

Answers

Answer:

A drawer or a box.

Explanation:

How does the speaker structure this part of the argument? Match each sentence to what it accomplishes. Match Term Definition Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore. A) State the claim of the argument There's also people in need, so you decide to blend your vacation with volunteering. B) Recognize the counterclaim Volunteering as a tourist, or voluntourism, seems like a great way to explore new regions and help people at the same time. C) Establish a problem with the counterclaim However, this D) Get the audience's attention While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference. E) Establish the topic

Answers

Answer:

Picture this: E

There’s also people: A

Volunteering as a tourist: D

However, this: B

While many teens might view : C

Explanation:

The speaker's structuring of the text has been indicated below:

D. Get the audience's attention: Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore.

E. Establish the topic:  There's also people in need, so you decide to blend your vacation with volunteering.

A) State the claim: Volunteering as a tourist, or voluntourism seems like a great way to explore new regions and help people at the same time.

B) Recognize the counterclaim: However, this

C) Establish a problem with the counterclaim: While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference.

What is a text structure?

Text structure refers to the manner of arranging the flow of ideas in a text.

The speaker in this argument began by getting the audience's attention, establishing a topic, stating a claim, and addressing a counterclaim.

Learn more about text structure here:

https://brainly.com/question/12053427

Why is it important to express love and affection to young children?

Answers

Answer:

Young children need love and affection to grow and succeed in life. Some studies proved that a lack of parental warmth and love can make children more stressed since parents put too much pressure on them to succeed without balancing it with affection. Love and affection help children to feel secure regardless of their accomplishments. This builds their confidence and self-esteem.

Explanation:

What book contain laws, commandments and rules by which we build a just and free society.

Answers

Answer:

Some options: The Bible, The Tanakh, The Quran,

Explanation: All these books contain commandments and rules by which we can build a just and free society.

Under line the examples of "radiation"
"light bulb giving off heat"
"cuddling with your warm dog"
"feeling heat while standing by campfire"
"smoke rising from a fire"
"sun heating a car"
"cooking pancakes in a pan"

Answers

Answer:

"light bulb giving off heat"

"feeling heat while standing by campfire"

"sun heating a car"

Explanation:

Radiations is one of the modes of heat transfer. Radiation involves the transfer of heat without a material medium for propagation of heat. In other words, radiation does not need matter to move from one point to another.

The following are examples of radiation;

"light bulb giving off heat"

"feeling heat while standing by campfire"

"sun heating a car"

In the above excerpt Welly is using what literary device?


Answers

where is the picture to show what I’m supposed to be answering

PLEASE HELP!!! BRAINEST AND 50 POINTS, I WOULD BE MOST GRATEFUL IF YOU HELP ME, THANK YOU!!!!!!!!!! READ THE ARTICLE FRIST!!

Answers

Answer:

Explanation:

On one hand, it should be free because many couples try to concieve in order to start a family, but they may not be able to pay the additional expenses. Everyone has the right to start a family, and cost should play no matter in it. On the other hand, it maybe shouldn't be free because there could be some people who can not afford to look after themselves, let alone raise a child. Another reason for why it should not be allowed is that IVF does not always work, as it is based on chances and is not a definitive answer

Plz help
English hw

Answers

Answer:

Explanation:

the first question means that you should always try something before judging at least once  

second: I personally agree

the fourth one:   I believe the author wants you to believe in trying new things

hope this helps

Which excerpt from "The Most Dangerous Game" is an example of foreshadowing?
"Can't see it," remarked Rainsford, trying to peer through the dank tropical night that was palpable as it pressed its thick warm blackness in upon the yacht.
Who cares how a jaguar feels? The world is made up of two classes--the hunters and the huntees. Luckily, you and I are hunters.
I hope the jaguar guns have come from Purdey's. We should have some good hunting up the Amazon.
I've seen you pick off a moose moving in the brown fall bush at four hundred yards, but even you can't see four miles or so through a moonless Caribbean night."

Answers

The second because it shows zaroffs idea of darwinism.

Answer:

Who cares how a jaguar feels? The world is made up of two classes--the hunters and the huntees. Luckily, you and I are hunters.

Explanation:

Read the summary paragraph for the article on service and answer the question that follows:
Service improves society, impacting the helpers as wel as those neoding assistance.It means being an active partcjpant in one's community, taking action
where it can be of benefit. Every person should make it a prionity to serve at least two
hours per week. It's an extremely important civic responsibility that is
invaluable to citizens most in need. Service creates improved comnmunities where people care about each other.

Which of the following makes a true statement about good summaries?

Good summaries include the writer's opinion on the article.

Good summaries focus on the support details from the body.

Good summaries provide all the data an author uses for support.

Good summaries objectively restate the thesis and crucial details.

Answers

Answer:

what

Explanation:

please answer questions number 4, 14,15 and 19​
change into passive voice

Answers

4. Should the tiger be preserved?

14. weren't you told to be here by 6 O'Clock?

15. were any questions asked about me?

19. Why were I not informed the change of plan by anyone?

Okay I've finished ur work!!

Answer:

question no.. 4: yes we should..!

Which statement best describes how the author uses
sound devices to create mood?
O The author uses onomatopoeia to create a
disjointed mood.
O The author uses onomatopoeia to create a joyful
mood.
O The author uses alliteration to create a playful mood.
O The author uses alliteration to create an angry
mood.

Answers

The statement that best describes how the author uses sound devices to create mood is B. The author uses onomatopoeia to create a joyful

mood.

What does onomatopoeia mean?

The process of developing a word that phonetically mimics, resembles, or alludes to the sound that it describes is known as onomatopoeia. An onomatopoeia is a word that sounds poetic. Animal noises like the oink, meow, roar, and chirp are frequently used as onomatopoeias.

Alliteration and onomatopoeia are literary devices that are employed to engage readers' senses by producing an auditory effect. By using words that mimic the sounds they make, writers can create sound in their works through onomatopoeia. This can enhance the drama and interest of a poem or other piece of writing.

Therefore, it should be noted that based on the information illustrated, it van be seen that the correct option is B.

Learn more about mood on:

https://brainly.com/question/7509362

#SPJ1

what does priortize means

Answers

It means to make it a priority or making it more important than other things such as a credit card or ID or drivers license

Hope this helps

Have a great day/night

Answer:

prioritize means to put something first

What does John Steinbeck believe is every writer’s purpose?

Answers

Answer:

to write books for kids

Explanation:

how do I write a sentence about a man with a pie with an action verb.​

Answers

Answer:

A man was eating a delicious pie.

Explanation:

The action verb is eating and the man and pie are included

plz help me with this as fast as you can

Answers

Answer:A

Explanation: and for number 2 c

Answer:

1. C

2. B

5. B

6. A

7. A

8. C

9. B

10. B

11. D

12. B

Part A

What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?

Many people now look for trash to pick up when they are visiting the beach.
Creating artwork can be both beautiful and horrifying.
Children enjoy the art displays of sea creatures.
Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.

Question 2

Part B

Which detail from the text best conveys the answer in Part A?

"She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas."
"'It's the only thing he's liked all day,' his grandmother said."
"An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art."
"All of the art is made from plastic trash that washed ashore, including a great white shark…"

Answers

Answer:

A. Art can be used to send a message about environmental awareness.

B. "She wants people to then take action based on that knowledge. Signs next to each art piece suggest simple ways to reduce the problem."

Explanation: on the quiz

Answer:

the answer is c

Explanation:

i took the test

In which sentence is the word habitual used as it is listed in the dictionary entry?
He habitual jogged the same path through the park.
Each morning the man and woman eat their habitual breakfast in the diner.
It is apparent that it is her habitual to sing while painting.
It seems everyone is willing to put up with the habitual of the neighbor's gossip.

Answers

Number two is correct because habitual is something that is repeated
Other Questions
The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep