B. How many members are in the House of Representatives? Why?

Answers

Answer 1

Answer:

There are 535 members.

Explanation:

Five delegates and one resident commissioner serve as non-voting members of the House, although they can vote in committee.

Answer 2

Answer:

435

Explanation:

commissioner serve as non-voting members of the House


Related Questions

Explain any 2 significance of public administration.​

Answers

Public administrators play a crucial role in aiding federal agencies, such as the Department of Health and Human Services and the Transportation Security Administration.

On a local level, public administrators organize efforts to improve communications and share data between public safety services

Can you sue and win if someone is black mailing you over something illegal you did. If not is there any thing else you can do to take legal action and protect yourself.

Answers

I’m not sure that you’d win the argument as you could possibly face repercussions of the act you did that was illegal...two wrongs won’t make a right basically.

There has been a high rate of bicycle accidents in your community. The local police department has decided to host free bicycle safety seminars at a local community center. The officers who conduct the trainings are being paid for the time they conduct these seminars.

Is this example a public policy?

Answers

Answer:

yes they are helping with the incidences of the bicycles

Explanation:

Yes they are helping by serving the public

Emile Durkheim believed that when people left their traditional farms and moved into the cities to work in factories, their behavior became:

A.
normal.

B.
normless.

C.
deviant.

D.
more conforming.

Answers

B is the correct answer

Emile Durkheim felt that as people left their customary fields to work in industries and relocated to cities, their conduct became normless. Thus, option (B) is correct.

What is the meaning of behavior?

Behavior refers to the action or the response made by the person in the particular situation. Every persons' behavior varies as it is influenced by the family background, society, cultures, traditions etc. The behavior tells about the nature or the character of the person.

The term normless can be defined as the thing that lacks the rules, regulation or the norm. According to the above situation, Emile Durkheim felt that as people left their customary fields to work in industries and relocated to cities, their conduct became normless.

Therefore, it can be concluded that option (B) is correct.

Learn more about behavior here:

https://brainly.com/question/8871012

#SPJ2

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

How can you institute a criminal action

Answers

Criminal procedure deals with the set of rules governing the series of proceedings through which the government enforces substantive criminal law.

Which of the following is a belief held by the theory of natural law?

Answers

According to natural law theory, all people have inherent rights, conferred not by act of legislation but by "God, nature, or reason." Natural law theory can also refer to "theories of ethics, theories of politics, theories of civil law, and theories of religious morality." Natural law has roots in Western philosophy.

Natural law - Wikipediahttps://en.wikipedia.org › wiki › Natural_law

Damian and Hunter are college roommates from very different walks of life. Damian was raised in a poverty-stricken city by a single mom. Hunter is the son of a small-town doctor and his socialite wife. Regardless, they get along well. Over time, they become known around campus as a good source for illegal drugs. For several years, Damian and Hunter run their business successfully. When the police finally catch up with them, they are both arrested. Following the theory of radical criminology, what is MOST likely going to happen to the two men?

A.
Damian will get an easier sentence because he did not have the advantages that Hunter did.

B.
Hunter will get a harder sentence because he had more privileges growing up.

C.
Both men will get equal sentences under the law.

D.
Damian will get a harder sentence because of his background.

Answers

Answer: D. Damian will get a harder sentence because of his background

Explanation:

Radical criminology bases its opinion on the fact that the state uses its power to make laws that will be beneficial to the ruling class while the working class are left out. It simply means that the laws made benefits the rich at the expense of the poor in the society.

Therefore, since Damian was raised in a poverty-stricken city by a single mom while Hunter is the son of a small-town doctor and his socialite wife, Damian will get a harder sentence because of his background.

What cases were important to freedom of speech?

Answers

Answer:

The U.S. Supreme Court has decided several cases involving the First Amendment rights of public school students, but the most often cited are Tinker v. Des Moines Independent Community School District (1969), Bethel School District No. 403 v. Fraser (1986) and Hazelwood School District v.

The course of action a government takes in response to an issue or problem is called
federalism.
A. Federalism
B. Bureaucracy
C. public policy.
d. interstate policy.

Answers

A. Federalism

:)
I am typing extra words because it won’t let me answer until I have 20 characters.
Federalism is the correct answer

juvenile means what?

Answers

Answer: A "juvenile" is a person who has not attained his eighteenth birthday, and "juvenile delinquency" is the violation of a law of the United States committed by a person prior to his eighteenth birthday which would have been a crime if committed by an adult.

please give brainlest if this helps!

In criminal justice systems a youth detention center, known as a juvenile detention center (JDC), juvenile detention, juvenile hall, or more colloquially as juvie/juvy, also sometimes referred as observation home or remand home is a prison for people under the age of 21, often termed juvenile delinquents, to which they ...

1.What conclusion can you draw about why excessive use of force can happen sometimes in the fields of policing and corrections?
Don't send me links!

Answers

Answer:

Answer Below:

Explanation:

With everything happening I am going to answer carefully; The use of excessive force may be the surroundings of the cop(A place where the cop could easily be hurt), the way the person being arrested acts, and if it happens the cop being corrupt.

Which of the following actions is illegal for selling alcohol

Answers

Answer:

no options

Explanation:

I’m not sure what the options are but reselling alcohols in some states in the United States is in fact illegal.

What is the default join type?

Answers

Ans: SQL inner join


The simplest and most common form of a join is the SQL inner join the default of the SQL join types used in most database management systems. It's the default SQL join you get when you use the join keyword by itself. The result of the SQL inner join includes rows from both the tables where the join conditions are met.

Answer:

If this is for edge....it’s A) inner

Explanation:

Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35​

Answers

Answer:

It is C.30 years old

Explanation:

Answer: to be senator you must be over the age of 30 years old. To be represenative a person must be 25 of age or older.
Explanation:This is specified in the U.S. Constitution. Most states in the U.S. also have age requirements for the offices of Governor, State Senator, and State Representative.


Please give me brainlyyy❤️❤️

Which television show or movie shows procedures/or a process to collect evidence from a violent crime scene that differs from the actual procedures/process that happen in real life. Then discuss how these two procedures or processes regarding evidence collection portrays the criminal investigation process and how these processes or procedures differ from the actual reality of a crime scene investigation.

* I’m not really. Interested in crime shows so I don’t have a clue

Answers

Answer:

Criminal law

Explanation:

Answer:

Mindhunter

America's Most Wanted

Criminal: UK

In Hamdan v. Rumsfeld , the U.S. Supreme Court held that detainees in Guantanamo:____.
a. ​deserved some due process and that the military commissions created at the time were not sufficient.
b. ​did not deserve some due process and that the military commissions created at the time were sufficient.
c. ​did not deserve some due process and the military commissions created at the time were not sufficient.
d. ​deserved some due process and that the military commissions created at the time were sufficient.

Answers

Answer:

c

Explanation:

The legalization of drugs is neither unwise nor immoral. It is not unwise because by legalizing drugs we would eliminate the illegal drug trade. Hence, by legalizing drugs, we would rid our nation of all the violence that goes along with the illegal drug trade. Furthermore, the legalization of drugs is not immoral because it can be combined with a massive program of moral education. The conclusion in a standard argument form is often presented as __________

Answers

Answer:

Inductive

Explanation:

Bistro Caterers contracts with Corporate Towers to cater the firm’s business meetings. Later, the contract between Bistro and Corporate is completely rescinded. Even later, Bistro offers to make a new deal. Corporate is willing to deal, but for a new price. Bistro and Corporate
a. may agree to a new contract, but it cannot include a new price.
b. must perform the part of their original contract that is executory.
c. must perform their original contract.
d. may agree to a new contract that includes the new price.

Answers

Answer:

d. may agree to a new contract that includes the new price.

Explanation:

A contract can be defined as an agreement between two or more parties (group of people) which gives rise to a mutual legal obligation or enforceable by law.

There are different types of contract in business and these includes: fixed-price contract, cost-plus contract, bilateral contract, implies contract, unilateral contract, adhesion contract, unconscionable contract, option contract, express contract, etc.

Mutual assent is a legal term which represents an agreement by both parties to a contract. When two parties to a contract both have an understanding of the parameters, terms and conditions surrounding a contract, it ultimately implies that they are in agreement; this is generally referred to as mutual assent.

Since the original contract has been completely rescinded (declared void, repealed or annulled), Bistro and Corporate may agree to a new contract that includes the new price based on mutual assent between the two parties.

Keisha committed a crime in New York, but the punishment for the crime is harsher in Georgia, so the prosecutor organizes her case to be transferred to Georgia

Answers

Answer:

Keisha has the right to be tried in New York under the Sixth Amendment: “In all criminal prosecutions, the accused shall enjoy the right to a speedy and public trial, by an impartial jury of the State and district wherein the crime shall have been committed[.]”

Explanation:

Keisha committed a crime in New York, but the punishment for the crime is harsher in Georgia, so the prosecutor organizes her case to be transferred to Georgia because the sixth Amendment protects a criminal defendant the right to be represented by an attorney during trial.

What is crime?

The term crime refers to the illegal activity. The crime is not allow to the country, if any person is commit the crime are go the jail. The legal punishable by the state in case of crime. The punishment is set according to the different crime. For example a person is harm another person property.

Keisha has the rights to be tried in New York underneath the Sixth Amendment, which states that "in all criminal proceedings, the accused shall have the right to a prompt and public trial, by an unbiased jury appointed by the state and jurisdiction wherein the crime may have been committed."

As a result, the conclusion of the sixth Amendment protects a criminal defendant the right to be represented by an attorney during trial are the aforementioned.

Learn more about on crime, here:

https://brainly.com/question/9997722

#SPJ2

what is the relationship between law and morality with regard to euthanasia? ​

Answers

Answer:

please give me brainlist and follow

Explanation:

The law plays no role in euthanasia if good fortune or good medicine allows such a death. Today, however, euthanasia all too often attracts a second meaning1, an act or omission designed to hasten death and thus relieve the suffering of a dying or incurably sick patient.

I need help please.

Answers

Answer:

the answer is true

Explanation:

because the force is greater than that which is needed to compel compliance

An attempt by the seller to limit responsibility to the consumer in case anything goes wrong.

A - Disclaimer
B - Warranty
C - Defect
D - Contract

Answers

Answer:

D) A contract.. that the obvious because when you do business with anyone you would want to have a contract on deck because people play games and also so if things go wrong you have proof in court.

WHAT CRIMES ARE COMMITTED BY BOTH MEN AND WOMEN (give 5 crimes)

Answers

, murder, robbery, assault, kidnapping.

Answer:

1. Embezzlement

2. Domestic Violence

3. Murder

4. Car Theft

5. Extortion

Explanation:

How is the citizen important in American heroes

Answers

Answer: they ply there important roles as citizens

Explanation:

____ and ____ are the two forms of contracts.

Answers

Answer:

fixed price contracts and cost-reimbursement contracts

networks
Guided Reading Activity
Economic Systems
Lesson 1 Scarcity and the Science of Economics
Review Questions

Answers

Answer:

Explanation:

networks

Guided Reading Activity

Economic Systems

Lesson 1 Scarcity and the Science of Economics

Review Questions

with reference to the life of ministry of Jesus identify activities which shows that he was a worker​

Answers

Answer:

Jesus was a "Blue-collar" construction worker. He also, performed miracles for His fellow disciples and, for the people who followed Him.

Explanation: Found My source online.

Plz answer questions 3-10 correctly, will give brainliest​

Answers

If farted in a police station is that destruction of property if my fart melted the chair

Which of the following would most likely be considered a violation of the Fourth Amendment?
OA.
Confiscating the cellphone of a student who made a bomb threat
OB.
Searching the lockers of all students with black hair
O c. Stopping a vehicle believed to be involved in a bank robbery
OD
Stopping and searching all cars at the US-Mexico border

Answers

Answer:

OB

Explanation:

There is no reason to confiscate them but people in all other options could be doing something, have done, or they are currently doing it. Everything but OB is reasonable.

Other Questions
straight a students are more successful ? a,b,c,d I need help with this 2 questions can someone help me pls I need it !!!!! how do you solve this ? Advanced Calculation Question:The physician orders 120 units/kg of a medication. The dose available is 10,000 units/mL. The patient weighs 70 kg.The nurse will administer mL of medication.(record your answer using one decimal place) Determine whether the function is periodic. If it is periodic, find the period. f(x)=7sin^3x a. 2pi b. 4pi c. Not periodic d. pi Clinicke Inc. sells merchandise of $800,000 in 2020 that includes a two-year limited warranty against manufacturing defects as part of the selling price. Warranty costs are estimated to be 1% of sales. If the company incurred $2,200 of actual costs in responding to warranty claims in 2020 (related to 2020 sales), how much should Clinicke record in warranty expense for 2020 What is orbit? A. An increase in centripetal motion and mass friction. B. Resistance of an object to avoid friction. C. Gravity causing a curved path as an object tries to go straight. D. How well an object floats. diarrhoea definition A. Find the volume of a rectangular room measuring 22.75 ft. x 30 ft. x 14 ft.B. Find the BTUs needed for that room if it faces South with poor insulation.Help asap i just dont understand Using the following categories, indicate the effects of the following transactions. Indicate the accounts affected and the amounts. (Enter any decreases to account balances with a minus sign.)a. During the period, customer balances are written off in the amount of $11,600.b. At the end of the period, bad debt expense is estimated to be $9,600. PART A: Which statement best expresses a theme of the short story?A. Meaningful friendships can come from unexpected places. B. Dont judge someone by their appearance.C. The bond between man and dog is unbreakable.D. Grief has the power to change even the gentlest creatures. Julio recibi $640.000: gast las partes para pagar sus estudios y la parte para reparar el auto, cunto dinero le queda? which expression is not equvialet to 28ax I really really need this please help fastWrite about your favorite subject ( social studies) Which of the following was a 20th-century proponent of expressivism?Group of answer choicesMillCalvinAyerDennett Part A Which structure does the author use to organize information in the text Water Efficiency Strategies? The author lists terms that define different kinds of water systems. The author shares examples of times that consumers tend to use the least amount of water. The author compares and contrasts three possible ways to conserve water in each paragraph. The author uses a heading for each method of conserving water. Question 2 Part B How does the section "Demand-Side Strategies for Water Suppliers" contribute to the structure and organization identified in Part A? It includes water efficiency measures that consumers and suppliers can implement. It informs the reader about programs that address each water conservation method in the text. On January 1, 2021, the Allegheny Corporation purchased equipment for $150,000. The estimated service life of the equipment is 10 years and the estimated residual value is $18,000. The equipment is expected to produce 240,000 units during its life. Required: Calculate depreciation for 2021 and 2022 using each of the following methods. 2. Double-declining-balance. PLEAse HElp ME PLeASe The local police department gives a detective test. Everyone who takes the test must have been a police officer for at least five years. The people taking the exam are rated from highest to lowest based on their test scores. If a detective position becomes available, it is filled on the basis of who has the highest score. What best describes this practice?