Answer:
#6
Explanation:
Radioactive dating technique
To confirm the ages obtained with magnetic records, and get an absolute age of the seafloor, scientists use the radioactive dating technique. When the lava solidifies at the ridges to form the new seafloor, radioactive elements coming from the mantle are trapped in it.
the biotic factors of each land biome are determined by its ___
climate
organisms
location
size
Answer:
climate
Explanation:
Throughout the reflection, make sure you have a copy of the Student Guide and your data table.
In your experiment, you tested this hypothesis:
The independent variable in this experiment was , and the dependent variable was
Answer:
hey tim they deleted our answer
Explanation:
Help please I need this I don’t understand
i dont understand too:(
Answer:
The first three boxes are Carbon dioxide (the 6th pic), water and sunlight, I cant figure out the middle box it could be nutrients, and one of the last box's is oxygen (the o)
Sorry im not much help im doing this too and like im literally stuck!
Through which of the following
would a sound wave travel the fastest?
a. Water vapor in the air
b. Water in the glass
c. Surrounding air
d. The glass
Answer:
D. The glass.
Explanation:
Sound travels fastest through solids. This is because molecules in a solid medium are much closer together than those in a liquid or gas, allowing sound waves to travel more quickly through it.
Hope this helps :D
If a P-Wave took 5 minutes to reach a seismic
station and the earthquake began at 4:23:05, what
time did the P Wave reach the station?
Answer: 4:28:05
Explanation: if it takes 5 minutes to reach a station, just add 5 to the amount of minutes you already have (23) to get 28. And the hour and seconds stay the same.
Gen K mengode rambut keriting dan gen k mengode rambut lurus, K dominan terhadap
k. Gen H mengode warna kulit hitam dan gen h mengode warna kulit putih. Kombinasi
dari gen-gen tersebut yang menunjukkan fenotip rambut keriting kulit putih adalah..
Answer:
The answer is "kkHh".
Explanation:
In this question, the Tight curls Gen K code and short hair k codes, which is used in the generation of the H black and gene H white color code, which is the gene H code. It is the synthesis of the genes that reveals it's solid black, and skin phenotype, that's why the kkHh is the correct answer is.
Identify a control group for the analysis shown in Figure 3. Justify analyzing SIRT3 protein level in four different cancer cell lines, as shown in Figure 1. Based on Figures 1 and 3, describe the relationship between SIRT3 expression and cytoplasmic ATP levels. Calculate the percent change in cytoplasmic ATP levels by SC+RNA cells compared with SC+plasmid cells.
Answer:
the control group is NS (normal stomach cells). the different cells can react different ways based on the specific cell because each cell in different people codes for different traits in each person therefore they are likely to react differently. the higher the SIRT3 expression the higher the cytoplasmic ATP levels. the difference is about 1 difference.
Explanation:
Given the following DNA strand TACGTATGCCGTATGGGCATT
a) What is the DNA compliment to given strand?
b) What is the mRNA compliment to the given strand?
Answer:
a) ATGCATACGGCATACCCGTAA
B) AUGCAUACGGCAUACCCGUAA
Explanation:
For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine
For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.
What is meant by a "catastrophic reaction" relating to a person with dementia ?
Answer:
A catastrophic reaction is an excessive reaction to something that may seem inconsequential to the in-home caregiver. The cause of a catastrophic reaction can be a number of things—the person with dementia simply may not be feeling well or might be feeling rushed and confused.
According to the data in the table, what percent of the elodea cells is water? Explain how you arrived at this conclusion.
Answer:
99%
Explanation:
at a salt solution concentration of 2%, plasmolysis first started to occur. So the other 98% in the "solution" would have just been water. Since water inside cells needs to be greater than the amount of water outside the cells, we can say that the amount of water inside the elodea cells was 99% so that it can allow hypertonic plasmolysis to occur.
good luck in honors bio>.<
Cellular respiration is a biological process in which glucose is broken down to form energy in the form of ATP. The reactants have a starting energy of 3564 kilojoules of energy, and the products have a resulting 2878 kilojoules of energy.
Which best describes cellular respiration?
It is an exothermic reaction because energy is lost.
It is an exothermic reaction because energy is gained.
It is an endothermic reaction because energy is lost.
It is an endothermic reaction because energy is gained.
Answer: (It is an endothermic reaction because energy is gained.)
It converts energy in food into a more usable form.
Answer:
d
Explanation:
Why do the cells used for reproduction only have half (½) of the DNA that other cells have?
Answer:
Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.
Explanation:
explain in details the mechanism of transportation in plants
Answer:
Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.
Explanation:
I hope I helped:)
What happens to the hair of a hog that is infested with lice?
Answer:
A. It clumps and falls out
Hoped this helped!
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
DNA stands for eoxyrevolution acid deoxyribonucleic acid.
Answer: yea im or re.tarded
Explanation:
Answer:
Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around. RNA strands are created using DNA strands as a template in a process called transcription,
Explanation:
Describe the effects of estrogen on
the developing female reproductive
system.
Answer:
In females, estrogens affect the ovaries, vagina, fallopian tubes, uterus, and mammary glands. In the ovaries, estrogens help to stimulate the growth of the egg follicle; they also stimulate the pituitary gland in the brain to release hormones that assist in follicular development.
11. Cheetahs have been through a genetic bottleneck; evidence for this is that
A little natural selection occurs in this species.
B. the body is long thin, and graceful.
c. there is very little genetic variability.
D. these cats are members of an endangered species.
E. they originally came from sm all areas of Africa.
Cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).
What is a genetic bottleneck?A genetic bottleneck is a natural process where a population and/or species lost part of this genetic diversity.
A genetic bottleneck is a process that can be caused by catastrophic natural disasters.The genetic bottleneck is evidenced by the lack of genetic variability.In conclusion, cheetahs have been through a genetic bottleneck; evidence for this is that there is very little genetic variability (Option c).
Learn more in:
https://brainly.com/question/8195651
9.Supposed 100 ants live in an & square cenoneter cs: pot gasswould be the population density of the ants?
A.12.5 per cm²
B.12.6 per cm²
C.12.7 per cm²
D.12.8 per cm²
Which of these characteristics is often used as a measure of an ecosystems health? A. The variety of species that lives there B. The number of people who live there C. The amount of population that occurs there D. The types of activities that can be done there
Answer:
A
Explanation:
Because the more species that live their can determine how well the environment is doing.And that their is enough resources for them to survive.
Can u pls help me this is due today I will give brainliest
Answer:
exmaple z
Explanation:
it is the heaviest so it would require more to push
PLEASE HELP
Fact vs. Opinion
Read each statement and decide if it is a fact (can be proven with evidence) or an opinion (personal belief).
8. Different cell types also have special duties, like building skin or bone, pumping out hormones, or making antibodies.
9. Animal cells are more interesting than plant cells.
10. Proteins are processed and lipids are manufactured in the smooth endoplasmic reticulum and Golgi apparatus.
Answer:
8 fact 9: opinion 10: fact
Explanation:
Answer:
8. Fact
9. Opinion
10. Fact
Which is not a likely economic tool to address environmental issues?
Emissions fees and taxes
Responsibility for a product from production to disposal
Small business liability relief
Defunding government regulation
Explanation:
Policy-makers have two broad types of instruments available for changing consumption and production habits in society. They can use traditional regulatory approaches (sometimes referred to as command-and-control approaches) that set specific standards across polluters, or they can use economic incentive or market-based policies that rely on market forces to correct for producer and consumer behavior. Incentives are extensively discussed in several EPA reports
Two basic types of traditional regulatory approaches exist. The first, a technology or design standard, mandates specific control technologies or production processes that polluters must use to meet an emissions standard. The second, a performance-based standard, also requires that polluters meet an emissions standard, but allows the polluters to choose any available method to meet that standard. Performance-based standards that are technology-based, for example, do not specify a particular technology, but rather consider what available and affordable technologies can achieve when establishing a limit on emissions. At times, EPA may completely ban or phase out the use or production of a particular product or pollutant, as it has done with chlorofluorocarbons (CFCs) and certain pesticides. Regulations can be uniform or can vary according to size of the polluting entity, production processes, or similar factors. Regulations are often tailored in this manner so that similar regulated entities are treated equally. MARK AS BRAINLIEST IF IT HELPS
A storm surge is a dangerous part of
a. a tornado.
c. the water cycle.
b. a thunderstorm.
d. a hurricane.
Answer:
your answer would be a hurricane
Answer:
D. Hurricane
Explanation:
I didn't solve this question on my own- the person above me did- credits to them!!! I just tested the answer to make sure it was the right answer and it is!!! Hope this helps!!! <3
which describes a eukaryotic cell,but not a prokaryotic cell?
an example of a community
Answer:
Community, also called biological community, in biology, an interacting group of various species in a common location. For example, a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi, constitutes a biological community.
Explanation:
What did astronauts take from
the moon?
bits of dust
rocks
bits of dust and rocks
Which of the following describes exploratory analysis?
Answer:
what are the options but the answer is exploratory data analysis is an approach to analyzing data sets to summarize their main characteristics
PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.
Answer:
No, not according to any sciences (unless you mean aliens as in immigrants)
Explanation:
There is no way that we are the only living thing in the entire world. There has to be another species out there. They might be wondering if there is another living thing out in space too.
What can you conclude about DNA from the idea that it is a cell's "brain” ?
A. it helps think.
B. it controls what cells do
C. it requires a lot of blood to operate properly
D. it is located at the top of the cell
The conclusion about DNA from the idea that it is a cell's "brain” is that it controls what cells do.
DNA:
DNA, also known as deoxyribonucleic acid, is the nucleic acid responsible for storing the genetic material of the cell. The DNA is found in the nucleus of eukaryotic cells or in the cytoplasm of prokaryotic cells. The DNA molecule produces proteins via the process of gene expression. The proteins, which acts as enzyme and hormone, controls cellular processes. Therefore, the conclusion about DNA from the idea that it is a cell's "brain” is that it controls what cells do.Learn more at: https://brainly.com/question/19365715?referrer=searchResults