An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.

Answers

Answer 1

Answer:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.

Explanation:

Answer 2

The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.

What is tsunami?

The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.

These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.

Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.

When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.

Thus, the correct option is C.

For more details regarding tsunami, visit:

https://brainly.com/question/14782736

#SPJ6


Related Questions

A scientist is studying a radioactive element that has a half-life of 63 years. Choose the correct answers from the drop-down menus to complete each statement about the element.

It will take
blank
years for half of the sample to decay.

In 189 years, blank
of the sample will be left.

Scientists can figure out how old a sample is by multiplying the blank
by the length of the half-life.

Answers

Answer:

It will take 63 years

In 189 years, one-eight of the sample will be left

By multiplying the number of half-life cycles

Explanation:

I just completed this assignment.

A scientist is studying a radioactive element that has a half-life of 63 years. It will take 63 years, In 189 years, one-eight of the sample will be left.

what is the meaning of half life ?

A radioactive element is defined as the material when it changes its atomic number or weight by emitting energy, the energy may be either Alpha, beta, or gamma forms of radiation.

Alpha is a Helium nucleus, a beta particle is an electron and a gamma is high energy electromagnetic radiation. Half-Life can be defined as the time required by which the radioactive substance to split into a different substance.

The half life  was first discovered by Ernest Rutherford and represented by the Ug or t1/2, If the radioactive element has one-hour of half-life, it means  one half of the element would decay within an hour and the remaining part would decay in another hour.

Learn more about half life, here:

brainly.com/question/16387602

#SPJ2

_____ are simple sugars.

Monosaccharides
Disaccharides
Polysaccharides
Lipids

Answers

Monosaccharides are simple sugars

Answer: monosaccharides

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Which image shows karst topography?

Ocean with palm trees at the beach.

A sinkhole.

Overhead view of an oxbow and fields.

Answers

Answer:

B

Explanation:

a sinkhole is the answer. I got it on edge 2020

Answer:

its B

Explanation:

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

hello I need help!!! did I get this right ​

Answers

Answer:

Yeah it is correct.

Explanation:

Things enter the cell through the cell membrane through either active or passive transport which can tell you that the cell membrane controls what goes in and out.

I believe so. I looked it up and it matched everything I found

scientist have been measuring increasing levels of greenhouse gases in Earth's atmosphere. How do increasing levels affect the atmosphere?

Answers

Well, we have a book to write on this topic but imma explain it briefly plus simply.

Global warming emphasizes the environment with rising temperatures, water shortages, increased fire threats, droughts, weeds and pest attacks, severe storm damage and salt attacks, to name just a few.(In simple words)

Now, we'd go briefly and discuss some common affects briefly :

Hotter days - The climate is getting more and more warmer and year 2015 was the hottest year ever record throughout the history. The Earth's temperature had already warmed by 1°C which is really dangerous. Rising sea levels - Rising sea levels due to climate change is the biggest problem causing natural calamities. Increased ocean temperatures are melting glaciers and ice caps all over the world. Melted ice increases the volume of water in our oceans. Warmer temperatures also result in the expansion of the water's mass, which causes sea levels to rise, threatening islands and coastal cities.More frequent and intense extreme weather - Extreme weather events like bushfires, cyclones, droughts and floods are becoming more common and more aggressive as a result of global warming.

Hope it helps <3

How does convection work and how does it move tectonic plates? *

Answers

Answer:

Convection is the process of warm fluids rising and cooler fluids sinking. Inside the Earth, convection is powered by heat mostly from the core. The slow circulation of rock in the mantle moves the tectonic plates at the surface.

Explanation:

Why are animals renewable resources?

Answers

They are renewable natural resources. They move round and round in cycles and never run out. For example a horse eats a plant the horse gets eating by another animal the cycle goes on an on an on

Answer:

They are renewable natural resources. They move round and round in cycles and never run out. When an animal like this cow eats a plant, it takes in nutrients. The nutrients are used in the animal's body and then many come out as waste, which returns the nutrients to the soil.

BIOLOGY, I need help on this one

Answers

This is a base deletion

Mt. Pinatubo, a volcano in the Philippines, erupted in 1991. The eruption resulted in the cooling of Earth's surface
for two years.
What can you deduce from the information given?
O Solar energy seeped through the atmosphere,
O The eruption caused sunspot activity to increase.
O The volcano released a lot of sulfur dioxide and ash,
O Greenhouse gases caused the cooling of Earth's surface.

Answers

Answer: this is easy, i think

Explanation:

The volcano released a lot of sulfur dioxide and ash

According to question, "C" which is the volcano released a lot of sulfur dioxide and ash.

What is a volcano and what causes its eruption?

When magma builds up in the magma chamber, it forces its way up to the surface and erupts, often causing volcanic eruptions.

In the ocean, volcanoes erupt along cracks that are opened in the ocean floor by the spreading of two plates called a mid-ocean ridge.

Thus, the volcano released a lot of sulfur dioxide and ash is correct.

To learn more about volcanoes click here:

https://brainly.com/question/12945128

Please help
Question is in photo

Answers

Answer:

the first one.

Explanation:

Before cells divide, they must replicate their entire genome. Explain why
replication of the genome prior to cell division is important.

Answers

Each time a cell divides into two daughter cells, its full genome is duplicated; for humans and other complex organisms, this duplication occurs in the nucleus. This minimizes the incidence of errors (mutations) that may greatly affect the resulting organism or its offspring. ...

HOPE THIS HELPED <3

Answer:

In order for all of the cells in your body to maintain a full genome, each cell must replicate its DNA before it divides so that a full genome can be allotted to each of its offspring cells. If DNA replication did not take place fully, or at all, the offspring cells would be missing some or all of the genome.

Explanation:

Need Help Due in 5 min: Earth Science

Answers:

hurricane


snowstorm


tornado


flooding

Answers

Snowstorm is the correct answer

Answer:  a snowstorm would occur

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.


30) These two equations are related because the BLANK of cellular respiration are the BLANK of photosynthesis. The BLANK of photosynthesis are the BLANK of cellular respiration.
Plz fill the blanks in :(

Answers

Answer:

Explanation:These reactions occur in the stroma the fluid filled area of a chloroplast ... Photosynthesis Respiration amp Interdependence Two of the 5 basic habitat resources are food and air. ... Without oxygen a cell can extract a net gain of only _____ molecules of ATP from ... Fill in the blanks in the Photosynthesis equation below 15.

help meeeeeeeeeeeeeeeee plz

Answers

Answer:

It would most likely be within the mantle. the mantle is in the interior of the earth;. So inner core.

Explanation:

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity

Answers

Answer:

A. Human Development index

Explanation:

The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.

hope i helped

its not gdp nor infant mortality nor carrying capacity

and much more

Answer: the answer is A

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Add the following complex numbers:
(6-2i)+(11+6i)
A. 17 + 4i
B. -5 + 8i
C. -5 +4i
D. 17 + 8i


HELP PLEASE

Answers

Answer:

A. 17 + 4i

Explanation:

‼️PLEASE HELP THIS IS MY LAST HOPE
List 6 amino acids found in turkey meat. Explain how those amino acids could be formed into a protein including an explanation of translation and transcription.

Answers

Amino acids

1. Tryptophan
2. Threonine
3. Isoleucine
4. Leucine
5. Lysine
6. Methionine
Transcription is a transfer for genetic instructions for DNA to mRNA In the nucleus. But for translation the instructions for mRNA in which is the message, reads and tRNA brings the correct sequence of the amino acids to the ribosome. Then the rRNA helps the bonds form between the amino acids in which its polypeptide which is protein. And makes a polypeptide chain or amino acid chain.
I hope this helps :)

How does the waste of the pandemic relate to the biosphere?

Answers

Answer:

I think because there aren't a lot of people working, so there is no one to pick up after careless people.

That is the first thing that popped up in my head :\

:D

Find the EXACT area of the shaded. The square has a side length of 24 meters.

Answers

Answer:

Explanation:

If the entire square is shaded and that 24m being the measurement of just one side just multiply 24 by 24 which is 576[tex]m^{2}[/tex]

If you are saying that 24 is the length of all of the sides combined just divide 24 by 4 to get one side and square it. 6 times 6 and you get 36[tex]m^{2}[/tex]

A hiker has become overwhelmed with heat while walking in the Grand Canyon. The hiker's body goes into overdrive to keep cool in the heat. The hiker needs to hydrate his or her cells. What process is used to regulate homeostasis?

A. Balanced equilibrium
B. Passive transport
C. Cellular transport
D. Hydration

Answers

I think D is the answer

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

Please help me please

Answers

Answer c
Because the lowest one is at the bottom near 5 and the top one is on 25m and for it to be at 11m will be the wrong answer.
THE CORRECT ANSWER IS C IT MAKES SENSE

There are some similarities between prokaryotic and eukaryotic cells. Which of the following structures is found in both prokaryotic and eukaryotic cells?

Answers

Answer:

Plasma membrane, cytoplasm, ribosomes, and DNA.

Explanation:

There are what eukaryotes and prokaryotes have in common.

What was Edwin Hubble's contribution to the field of astronomy?

A. He discovered variable stars.

B. He proved that the heliocentric model accurately described our solar system.

C. He found a relationship between the period luminosity and distance of stars.

D. He proved that the universe is finite.

E. He discovered that the universe was expanding.

Answers

Answer:

B he proved that the heliocéntrico model accurately described tour solar system

Explanation:

des

i think

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

Other Questions
Which of the following choices BEST describes the process of handling emotions?A.recognize, accept, control, adopt positive strategies, cope effectivelyB.pretend nothing is wrong, keep things to yourself, move on quicklyC.realize stress happens, accept it's unavoidable, do nothing about itD.all of the above FREE 9 = Tucson ..... PLEASEEE HELP ME PLEASEE!! Each part of the cell is specialized to perform certain functions.Chromosome duplication, which happens during mitosis, occurs in the _______. A. golgi body B. cytoplasm C. nucleus D. lysosomehelp please which type of energy would most likely create the worst environment disaster from an accident or spill ((help please)). Identify any constraints on the domain.Every day Isabel swims 10 to 20 laps in a 50-meter pool. She tracks the numbers of laps she swims and how long it takes her to complete the laps, inminutesChoose the correct answer below.O A. The domain consists of all integers greater than or equal to 0.OB. The domain consists of all integers greater than 0 and less than or equal to 20.OC. The domain consists of all integers greater than or equal to 0 and less than or equal to 20D. The domain consists of all integers greater than or equal to 10 and less than or equal to 20.E. The domain consists of all integers less than or equal to 20. Please help, I only have 30 minutes left! ); what are causes of uneven development? I need all the causes and one explained Whats 123.45 + 67.891 Step By Step? When the stock market crashed in 1929 who was president PLEASE ANWSER THIS 1 QUESTION What is the fifth term in the sequence 17.3, 34.3, 51.3, 68.3...?A 77.7B 85C 85.3D 89.7 ok yall i need help and yall kinda no treading the question fully READ ITTTTT, i will give brainleist Challenge You have 2 different savings accounts. For Account A, the simple interest earned after 21 months is $8.66. For Account B, the simple interest eamed after 33 months is $34.65. If the interest rate is 3.3% for Account A and 2.1% for Account B, how much is the principal in each account? Which account earned you the most interest the first month? Explain your answer. Account A has a principal of $. (Round to the nearest dollar as needed.) Jane Dough sells her doughnuts for $0.15 more than what it costs her to make each doughnut. If you can buy 2 dozen doughnuts for $8.40, how much does it cost Jane to make each doughnut? Plz help me answer these! I rlly need help What is a product of respiration What did King George III place in the colonies without their permission even during times of peace?1 British coal2 British troops3 Plum pudding4 Spanish cattle Society pays the costs of alcohol related collisions either directly through public assistance or indirectlythrough higher insurance and health costs.) true) false PLEASE HELP. What is the half life of the element in the picture?