Answer:
are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.
Explanation:
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil
Answer:
B)Magma
Explanation:
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
Why are there more producers than nutrients? (In an ecosystem, more specifically, regarding trophic levels.)
Explanation:
any step in a nutritive series, or food chain, of an ecosystem dead organisms and waste materials into nutrients usable by the producers
A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False
Answer:
Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.
Answer:
False
Explanation:
Which statements accurately describe fermentation? Select two options.
Oxygen is present during this process.
Cells may convert pyruvic acid to lactic acid.
NAD+ is converted to NADH.
Fermentation is an anaerobic process.
Additional ATP is produced after glycolysis.
Answer:
The answers are the second and fourth ones.
Explanation:
I did the assignment.
The statements that accurately describe fermentation are cells may convert pyruvic acid to lactic acid, and fermentation is an anaerobic process. The correct options are B and D.
What is fermentation?Fermentation is an anaerobic chemical process that breaks down molecules like glucose. More specifically, fermentation is the bubbling that happens during the creation of wine and beer, a procedure that has been around for at least 10,000 years.
It is different from aerobic respiration because it occurs in the absence of oxygen and aerobic respiration occurs in the presence of oxygen. The product of fermentation is lactic acid, which is produced from pyruvic acid.
Thus, the correct options are: B, Cells may convert pyruvic acid to lactic acid, and D, Fermentation is an anaerobic process.
To learn more about fermentation, refer to the link:
https://brainly.com/question/14525128
#SPJ6
Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem
Why might Ponyboy have idolized Pual Newman?
PLEASE HELP ME ITS MY FINALE !!!
The chart below shows the gravitational force between each pair of objects.
0.0000025 N
588 N
0.000358 N
0.000000067 N
Which pair of objects is experiencing the least gravitational force?
PREVIOUS
Answer:The answer is the person and the tennis ball :)
Explanation:
:-) :-) :-) :-) :-) :-) :-) :-) :-)
Please help
Answer:
B
Explanation:
sorry if im wrong!!!
I need help with this (last question I had had the picture all black)
Answer:
I only know A
I think it's the lap
what RNA nitrogen bases match with the following DNA nitrogen bases?
Which plant propagation process insures some genetic diversity?
Answer:
Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.
Explanation:
Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.
Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.
What is the purpose of the other tube of water?
Explanation:
cant see photo
Answer:
delude the other thing
there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain
Explanation:
Which statement best explains the myth about how Romulus and Remus founded Rome?
Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.
Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer
please help i will give brainlist
Answer:
I think it's c hope I hope I helped if not I'm sorry:(
How does the force of gravity move objects in the solar system?
Answer:
One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun
Explanation:
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
what was not included in john dalton's description of the atom
Answer:
Nucleus containing protons and neutrons and electrons
Explanation:
Answer:
This is what i found-
Explanation:
The indivisibility of an atom was proved wrong: an atom can be further subdivided into protons, neutrons and electrons. However an atom is the smallest particle that takes part in chemical reactions. According to Dalton, the atoms of same element are similar in all respects.
Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.
Answer:
The answer is B
B. They are both made of subatomic particles.
Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?
Answer:
3.5264 x [tex]10^{7}[/tex]
Explanation:
The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.
In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.
So the short ton produced will be
= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102
= 3.5264 x [tex]10^{7}[/tex] short ton.
Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.
There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles
Answer:
nucleus
Explanation:
chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.
The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.
What are eukaryotic cells?Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.
There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.
The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.
Thus, the correct option is C. nucleus.
To learn more about eukaryotic cells, refer to the link:
https://brainly.com/question/982048
#SPJ6
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
Why is biodiversity important for ecosystems?
Answer:to stop from extinction
Explanation: