Answer:
the cell wall is what gives the plants its angular shape. :)
Explanation:
Describe an example of the first law of thermodynamics
Answer: According to the first law of thermodynamics, energy can be transferred from place to place or changed between different forms, but it cannot be created or destroyed. For instance, light bulbs transform electrical energy into light energy, and gas stoves transform chemical energy from natural gas into heat energy.
Explanation:
Answer: The first law of thermodynamics states that: energy can neither be destroyed or created, it can only change forms. An example of this in an ecosystem would be when a plant absorbs the sun's energy and photosynthesizes, storing the energy as glucose.
Explanation:
What is a compound give an example?
Answer:
2 elements chemically joined together. An emample is Ironoxie
Explanation:
Answer:
A compound is a mixture of elements.
Explanation:
examples:
Calcium carbonate
Potassium nitrate
Hydrogen peroxide
Water
this is for a timed test !
Answer:
I guess it's
Explanation:
C. Atmosphere and hydrosphere
.
.
Sorry if I'm wrong!
pls help will give brainliest
Answer:
C
Explanation:
explain the ten central themes of biology
Answer:
The five central themes of biology are structure and function of cells, interactions between organisms, homeostasis, reproduction and genetics, and evolution.
When scientists discuss the Sixth Extinction, they are referring to which pattern in the rate of extinction?
Explanation:
The Holocene extinction, otherwise referred to as the sixth mass extinction or Anthropocene extinction, is an ongoing extinction event of species during the present Holocene epoch (with the more recent time sometimes called Anthropocene) as a result of human activity.[3][4][5] The included extinctions span numerous families of plants[6] and animals, including mammals, birds, reptiles, amphibians, fishes and invertebrates. With widespread degradation of highly biodiverse habitats such as coral reefs and rainforests, as well as other areas, the vast majority of these extinctions are thought to be undocumented, as the species are undiscovered at the time of their extinction, or no one has yet discovered their extinction. The current rate of extinction of species is estimated at 100 to 1,000 times higher than natural background extinction rates.
.
please. follow. me
which is a metamorphic process
ANSWER ASAP!
A. Weathering
b. Melting
c. Lithification
d. Meteorite impact
Answer:
Melting
Explanation:
Metamorphic because it is characterized as "..rock that has undergone transformation by heat, pressure, or other natural agencies.."
Why is it impossible for the atomic number of an element to be greater than its mass number?
answer: The atoms of different elements all have different numbers of protons. Meanwhile, the mass number of an atom consists of the total number of protons and neutrons it contains
Explanation:
Name two cell structures plant cells have that animals do not have and one structure that looks very different in a plant and animal cell (think size).
Answer:
Plant cells have a cell wall and chloroplasts and the cell wall gives the cell a rectangular shape unlike animal cells which have a round shape because we only have a cell membrane.
Answer:
plant cells have a cell wall . animals do not have and one structure that looks very different in a plant and animal cell
Explanation:
Which statement describes a cell part needed by the cell to make proteins?
Answer: The nucleus contains DNA.
Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.
Answer:
The correct answer would be - low flower density and low deep flower proportion
Explanation:
To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.
To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.
Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.
This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.
How do flower visitors diverse the traits?It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.
The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.
In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.
Therefore, the correct answer is low flower density and low deep flower proportion.
Learn more about the flower density here:
https://brainly.com/question/11253692
Which of the following is not considered a living thing?
a. soil
b. oak trees
c. sharks
d. pandas
Please answer quickly!! Timed test! Which term is correctly paired with its role in the body? A) Insulin – a sugar that regulates blood glycogen levels B) ADP – a molecule that releases energy when it forms ATP C) Glycogen – a hormone found in blood that regulates blood glucose levels D) Glucose – a sugar found in blood that can be broken down to produce ATP
Answer:
The correct answer is - D) Glucose – a sugar found in blood that can be broken down to produce ATP
Explanation:
Insulin is a hormone produced by the beta cells of pancrease that takes up the glucose from the bloodstram and make gucose available to the cells of the body to produce energy by the process of cellular respiartion. Glucose is breaken down to its smaller units and produced high amount of energy in the form of ATP. Glycogen is form of sugar that is stores in the muscle and othe cell for the energy in abscence or low glucose level in blood stream. ADP is a molecule know as adesnosine pyrophosphate or diphosphate which is play role in flow of energy. ADP molecules requires energy to form ATP molecule and when ATP splits into ADP and Pi releases high amount of energy.
Answer:
D glucose – a sugar found in blood that can be broken down to produce ATP
Explanation:
I took it on eng
All cells divide and reproduce the same way ... true or false explanation needed
Answer:
False
Explanation:
False because cells can reproduce in two ways. Mitosis, the process of making new body cells or cell division. OR Meiosis where there is genetic information transfered between cells such as how humans are made.
All cells do not divide and reproduce the same way since there are two methods for cells to divide. So, the given statement is False.
What is Cell division?The process by which a parent cell divides into two daughter cells is known as cell division. Cell growth and chromosome replication precede cell division, which often happens as part of a longer cell cycle. Usually, cell division happens as part of a longer cell cycle where the DNA is reproduced as the cell nucleus divides during cell division.
Meiosis and mitosis are the two processes through which cells can reproduce. The process of creating new body cells, or mitosis, differs from meiosis, which is the process by which genetic material is passed between cells, as in the creation of humans. Thus, not all cells divide and reproduce in the same way.
Therefore, the given statement is False.
Learn more about Cell division, here:
https://brainly.com/question/29773280
#SPJ2
Question 3 (3 points) (03.06 LC)
Select the correct statement describing the relative fitness in soapberry bugs.
A soapberry bug with high relative fitness feeds more successfully on fruits than do other bugs.
A soapberry bug with high relative fitness has a high number of offspring that survive to reproductive age.
A soapberry bug with high relative fitness has more mates than other bugs.
A soapberry bug with high relative fitness stays with one mate through its lifetime.
Answer:
B
Explanation:
I took the test 1 hours ago
Which is most likely the first step in a basic food chain?
autotrophic plants
This is the answer
Question 19 (1 point)
Which of the following is an example that includes evidence of a chemical reaction?
Answer:
sugar that is burned off gives an odor and turns brown and then black is a chemical change
The measure of chemical energy in cells and in food the energy available from high energy bonds in organic molecules
Answer: Cellular respiration
Explanation:
1. Which of these decreases as we
move from summer to winter?
O the amount of photosynthesis
occuring
O vegetation
O food supplies
all of these
Answer:
I believe the answer is All of them. But I'm not 100% sure.
ASAP!!!!!!! I NEED HELP
Why are there two sets of phases during meiosis, but only one during mitosis? Think about what is different about meiosis and mitosis
Answer:
Mitosis is the cell cycle for somatic cells which are diploid (2n).
Meiosis is the cell cycle for germ cells (gametes) where they are haploid (n) so that is why they have two sets of phases.
Explanation:
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
1. Are the following cell parts located in a plant cell, animal cell or both?
-Nucleus
-Cell Wall
-Mitochondria
-Cytoplasm
-Chloroplasts
-Vacuole
-Cell Membrane
Answer:
1. both
2. Plant cell
3. Plant cell
4. both
5. Plant cell
6. Both
7. Both
Explanation:
Plant cells have a cell wall and a cell membrane, unlike animal cells that only have a cell membrane.
Both have a cytoplasm, vacuole, mitochondria, and a nucleus.
Hope this is correct. Good luck with your studies.
Both plant cell and animal cell have a nucleus, mitochondria, cytoplasm, and cell membrane. Only a plant cell have cell wall, chloroplast and vacuole.
Difference between Plant cell and Animal Cell?Plant cells are the unit of plants. These cells are present in all green and non-green cells in a plant. However, an animal cell is the fundamental unit of an animal. Different types of animal cells make up an organism.
Plant cell contain an outermost covering called the cell wall. It protects them from shock and provides mechanical strength to the cell. It is absent in the animal cell.
Chloroplast is also present in the plant cells whereas it is absent in the animal cells. It is a double-membranous structure. A chloroplast is responsible for the process of photosynthesis as it contains chlorophyll pigment. A vacuole is also present in the plant cell and absent in an animal cell. The vacuole is responsible for the storage of reserved food materials in the form of complex sugars.
Learn more about Plant cell here:
https://brainly.com/question/1493437
#SPJ2
What are the genotypic and phenotypic distributions for the F1 and F2 generations from a cross between a chick with black (BB) feathers and chicken with white (WW) feathers if the color is determined by alleles that show codominance. The heterozygote is an erminette chicken, which is black and white speckled.
Answer:
Please find the punnet square to this question as an attachment
F1 generation:
genotype = BW
Phenotype = Erminette offsprings
F2 generation:
genotype = BB (1): BW(2): WW(1)
Phenotype = 1 Black, 2 Erminette, 1White
Explanation:
This question involves a gene coding for feather color in chickens. The allele for black feathers (B) is codominant with the allele for white feathers (W) to form an erminette chicken (black and white speckles).
According to this question, a cross between a chick with black (BB) feathers and chicken with white (WW) feathers will result in an all erminette chicken (BW) in the F1 generation (see attached image)
Also, in the F2 generation got by self-crossing the Erminette genotype in the F1 generation (BW), the following genotypic and phenotypic ratios are observed:
Genotypic ratio = BB (1): BW(2): WW(1)
Phenotypic ratio = 1 Black, 2 Erminette, 1White
What typc of molecule is shown in the diagram?
the 3rd consumer level in the food chain is never normally eaten explain what usually becomes of them.
Answer:
Plants and algae make their own food and are called producers. Level 2: Herbivores eat plants and are called primary consumers. Level 3: Carnivores that eat herbivores are called secondary consumers. Level 4: Carnivores that eat other carnivores are called tertiary consumers.
Explanation:
.....
Which of the following statements is true?
Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.
Answer:
1 one is true
2 is true
3 is falase
Answer:
a
Explanation:
what is an energy transformation?
Answer: Energy transformation is the process of changing energy from one form to another.
Explanation: Remember that energy cannot be created nor destroyed but it can be transferred or changed from one form to another. For example, chemical to mechanical or electrical to thermal.
If Rochester were a cell, what would be the nucleus?
A.Town hall
B.the vc!
C.Rochester High school
D.Rochester Adams High school
E.Stoney Creek High School
Answer:
correct answer is A
Explanation:
nucleus is most important part of a cell as a town hall would be to a city
What would happen to a freshwater fish in the ocean?
a its cells would not swell or shrink
b. its cells would shrink and the fish would die
cits cells would swell and the fish would die
HELP 100 POINTS TO WHO CAN HELP
HOW DOES THE MEIOSIS PROCESS WORK ?
What is different between meiosis and mitosis?
Whats the different between haploid and diploid?
Answer:
Meiosis is broken down into several stages. Each cell in the process of meiosis involves the cell growing, dividing, splitting, and dividing again in order to produce the four cells at the end of the process. This cellular process is one of the more common processes of biology, but it is also the reason why people have some traits over others.
Explanation:
The difference between mitosis and meiosis is in the process by which each form daughter cells from a parent cell. Mitosis has one round of cellular division and genetic separation whereas meiosis has two rounds.
The key difference between haploid and diploid is that haploid is the state of having half the usual number of chromosomes while diploid is the state of having the usual number of chromosomes in the genome of a cell.