All living things are made of one or more cells. What plant cell structure gives the cell its angular shape

Answers

Answer 1

Answer:

the cell wall is what gives the plants its angular shape. :)

Explanation:


Related Questions

Describe an example of the first law of thermodynamics

Answers

Answer:  According to the first law of thermodynamics, energy can be transferred from place to place or changed between different forms, but it cannot be created or destroyed. For instance, light bulbs transform electrical energy into light energy, and gas stoves transform chemical energy from natural gas into heat energy.

Explanation:

Answer: The first law of thermodynamics states that: energy can neither be destroyed or created, it can only change forms. An example of this in an ecosystem would be when a plant absorbs the sun's energy and photosynthesizes, storing the energy as glucose.

Explanation:

What is a compound give an example?

Answers

Answer:

2 elements chemically joined together. An emample is Ironoxie

Explanation:

Answer:

A compound is a mixture of elements.

Explanation:

examples:

Calcium carbonate

Potassium nitrate

Hydrogen peroxide

Water

this is for a timed test !

Answers

Answer:

I guess it's

Explanation:

C. Atmosphere and hydrosphere

.

.

Sorry if I'm wrong!

pls help will give brainliest

Answers

Answer:

C

Explanation:

explain the ten central themes of biology

Answers

Answer:

The five central themes of biology are structure and function of cells, interactions between organisms, homeostasis, reproduction and genetics, and evolution.

When scientists discuss the Sixth Extinction, they are referring to which pattern in the rate of extinction?

Answers

Explanation:

The Holocene extinction, otherwise referred to as the sixth mass extinction or Anthropocene extinction, is an ongoing extinction event of species during the present Holocene epoch (with the more recent time sometimes called Anthropocene) as a result of human activity.[3][4][5] The included extinctions span numerous families of plants[6] and animals, including mammals, birds, reptiles, amphibians, fishes and invertebrates. With widespread degradation of highly biodiverse habitats such as coral reefs and rainforests, as well as other areas, the vast majority of these extinctions are thought to be undocumented, as the species are undiscovered at the time of their extinction, or no one has yet discovered their extinction. The current rate of extinction of species is estimated at 100 to 1,000 times higher than natural background extinction rates.

.

please. follow. me

which is a metamorphic process
ANSWER ASAP!

A. Weathering
b. Melting
c. Lithification
d. Meteorite impact

Answers

Answer:

Melting

Explanation:

Metamorphic because it is characterized as "..rock that has undergone transformation by heat, pressure, or other natural agencies.."

Why is it impossible for the atomic number of an element to be greater than its mass number?​

Answers

answer: The atoms of different elements all have different numbers of protons. Meanwhile, the mass number of an atom consists of the total number of protons and neutrons it contains

Explanation:

The atoms of different elements all have different numbers of protons. Meanwhile, the mass number of an atom consists of the total number of protons and neutrons it contains. An atom's mass number can never be smaller than its atomic number, and while it can be the same it is normally larger.

Name two cell structures plant cells have that animals do not have and one structure that looks very different in a plant and animal cell (think size).

Answers

Answer:

Plant cells have a cell wall and chloroplasts and the cell wall gives the cell a rectangular shape unlike animal cells which have a round shape because we only have a cell membrane.

Answer:

plant cells have a cell wall . animals do not have and one structure that looks very different in a plant and animal cell

Explanation:

Which statement describes a cell part needed by the cell to make proteins?

Answers

Need the statements added to your question

Answer: The nucleus contains DNA.

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

Which of the following is not considered a living thing?
a. soil
b. oak trees
c. sharks
d. pandas

Answers

the answer would be soil the other person is wrong please give me branliest(:

Please answer quickly!! Timed test! Which term is correctly paired with its role in the body? A) Insulin – a sugar that regulates blood glycogen levels B) ADP – a molecule that releases energy when it forms ATP C) Glycogen – a hormone found in blood that regulates blood glucose levels D) Glucose – a sugar found in blood that can be broken down to produce ATP

Answers

Answer:

The correct answer is -  D) Glucose – a sugar found in blood that can be broken down to produce ATP

Explanation:

Insulin is a hormone produced by the beta cells of pancrease that takes up the glucose from the bloodstram and make gucose available to the cells of the body to produce energy by the process of cellular respiartion. Glucose is breaken down to its smaller units and produced high amount of energy in the form of ATP. Glycogen is form of sugar that is stores in the muscle and othe cell for the energy in abscence or low glucose level in blood stream. ADP is a molecule know as adesnosine pyrophosphate or diphosphate which is play role in flow of energy. ADP molecules requires energy to form ATP molecule and when ATP splits into ADP and Pi releases high amount of energy.

Answer:

D glucose – a sugar found in blood that can be broken down to produce ATP

Explanation:

I took it on eng

All cells divide and reproduce the same way ... true or false explanation needed

Answers

Answer:

False

Explanation:

False because cells can reproduce in two ways. Mitosis, the process of making new body cells or cell division. OR Meiosis where there is genetic information transfered  between cells such as how humans are made.

All cells do not divide and reproduce the same way since there are two methods for cells to divide. So, the given statement is False.

What is Cell division?

The process by which a parent cell divides into two daughter cells is known as cell division. Cell growth and chromosome replication precede cell division, which often happens as part of a longer cell cycle. Usually, cell division happens as part of a longer cell cycle where the DNA is reproduced as the cell nucleus divides during cell division.

Meiosis and mitosis are the two processes through which cells can reproduce. The process of creating new body cells, or mitosis, differs from meiosis, which is the process by which genetic material is passed between cells, as in the creation of humans. Thus, not all cells divide and reproduce in the same way.

Therefore, the given statement is False.

Learn more about Cell division, here:

https://brainly.com/question/29773280

#SPJ2

Question 3 (3 points) (03.06 LC)
Select the correct statement describing the relative fitness in soapberry bugs.

A soapberry bug with high relative fitness feeds more successfully on fruits than do other bugs.

A soapberry bug with high relative fitness has a high number of offspring that survive to reproductive age.

A soapberry bug with high relative fitness has more mates than other bugs.

A soapberry bug with high relative fitness stays with one mate through its lifetime.

Answers

Answer:

B

Explanation:

I took the test 1 hours ago

Which is most likely the first step in a basic food chain? ​

Answers

autotrophic plants

This is the answer

producers use the energy from the sun to create their own food :)

Question 19 (1 point)
Which of the following is an example that includes evidence of a chemical reaction?

Answers

Answer:

sugar that is burned off gives an odor and turns brown and then black is a chemical change

The measure of chemical energy in cells and in food the energy available from high energy bonds in organic molecules

Answers

Answer: Cellular respiration

Explanation:

1. Which of these decreases as we
move from summer to winter?
O the amount of photosynthesis
occuring
O vegetation
O food supplies
all of these

Answers

Answer:

I believe the answer is All of them. But I'm not 100% sure.

ASAP!!!!!!! I NEED HELP




Why are there two sets of phases during meiosis, but only one during mitosis? Think about what is different about meiosis and mitosis

Answers

Answer:

Mitosis is the cell cycle for somatic cells which are diploid (2n).

Meiosis is the cell cycle for germ cells (gametes) where they are haploid (n) so that is why they have two sets of phases.

Explanation:

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

1. Are the following cell parts located in a plant cell, animal cell or both?
-Nucleus
-Cell Wall
-Mitochondria
-Cytoplasm
-Chloroplasts
-Vacuole
-Cell Membrane

Answers

Answer:

1. both

2. Plant cell

3. Plant cell

4. both

5. Plant cell

6. Both

7. Both

Explanation:

Plant cells have a cell wall and a cell membrane, unlike animal cells that only have a cell membrane.

Both have a cytoplasm, vacuole, mitochondria, and a nucleus.

Hope this is correct. Good luck with your studies.

Both plant cell and animal cell have a nucleus, mitochondria, cytoplasm, and cell membrane. Only a plant cell have cell wall, chloroplast and vacuole.

Difference between Plant cell and Animal Cell?

Plant cells are the unit of plants. These cells are present in all green and non-green cells in a plant. However, an animal cell is the fundamental unit of an animal. Different types of animal cells make up an organism.

Plant cell contain an outermost covering called the cell wall. It protects them from shock and provides mechanical strength to the cell. It is absent in the animal cell.

Chloroplast is also present in the plant cells whereas it is absent in the animal cells. It is a double-membranous structure. A chloroplast is responsible for the process of photosynthesis as it contains chlorophyll pigment. A vacuole is also present in the plant cell and absent in an animal cell. The vacuole is responsible for the storage of reserved food materials in the form of complex sugars.

Learn more about Plant cell here:

https://brainly.com/question/1493437

#SPJ2

What are the genotypic and phenotypic distributions for the F1 and F2 generations from a cross between a chick with black (BB) feathers and chicken with white (WW) feathers if the color is determined by alleles that show codominance. The heterozygote is an erminette chicken, which is black and white speckled.

Answers

Answer:

Please find the punnet square to this question as an attachment

F1 generation:

genotype = BW

Phenotype = Erminette offsprings

F2 generation:

genotype = BB (1): BW(2): WW(1)

Phenotype = 1 Black, 2 Erminette, 1White

Explanation:

This question involves a gene coding for feather color in chickens. The allele for black feathers (B) is codominant with the allele for white feathers (W) to form an erminette chicken (black and white speckles).

According to this question, a cross between a chick with black (BB) feathers and chicken with white (WW) feathers will result in an all erminette chicken (BW) in the F1 generation (see attached image)

Also, in the F2 generation got by self-crossing the Erminette genotype in the F1 generation (BW), the following genotypic and phenotypic ratios are observed:

Genotypic ratio = BB (1): BW(2): WW(1)

Phenotypic ratio = 1 Black, 2 Erminette, 1White

What typc of molecule is shown in the diagram?

Answers

It's B. Carbohydrates

the 3rd consumer level in the food chain is never normally eaten explain what usually becomes of them.​

Answers

Answer:

Plants and algae make their own food and are called producers. Level 2: Herbivores eat plants and are called primary consumers. Level 3: Carnivores that eat herbivores are called secondary consumers. Level 4: Carnivores that eat other carnivores are called tertiary consumers.

Explanation:

.....

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

what is an energy transformation?​

Answers

Answer: Energy transformation is the process of changing energy from one form to another.

Explanation: Remember that energy cannot be created nor destroyed but it can be transferred or changed from one form to another. For example, chemical to mechanical or electrical to thermal.

If Rochester were a cell, what would be the nucleus?

A.Town hall
B.the vc!
C.Rochester High school
D.Rochester Adams High school
E.Stoney Creek High School

Answers

Answer:

correct answer is A

Explanation:

nucleus is most important part of a cell as a town hall would be to a city

answering it any other way wouldn’t even make sense, but id choose A

What would happen to a freshwater fish in the ocean?

a its cells would not swell or shrink
b. its cells would shrink and the fish would die
cits cells would swell and the fish would die

Answers

The answer is C.!!!! BRANLIEST plzzzzz
C i believe. Not 100% tho so be carful

HELP 100 POINTS TO WHO CAN HELP


HOW DOES THE MEIOSIS PROCESS WORK ?

What is different between meiosis and mitosis?

Whats the different between haploid and diploid?

Answers

Answer:

Meiosis is broken down into several stages. Each cell in the process of meiosis involves the cell growing, dividing, splitting, and dividing again in order to produce the four cells at the end of the process. This cellular process is one of the more common processes of biology, but it is also the reason why people have some traits over others.

Explanation:

The difference between mitosis and meiosis is in the process by which each form daughter cells from a parent cell. Mitosis has one round of cellular division and genetic separation whereas meiosis has two rounds.

The key difference between haploid and diploid is that haploid is the state of having half the usual number of chromosomes while diploid is the state of having the usual number of chromosomes in the genome of a cell.

Other Questions
Who is best A.Korbyn B.Audrey Focus your answer on what causes a genetic disorder (be specific) and what happens from there. Use the terms below in your answer.protein nucleus chromosome ribosome gene hemoglobin How did the Twenty-fourth Amendment to the Constitution affect African Americans?By allowing citizens to directly elect senators, it gave African Americans a greater voice in the government.O By eliminating poll taxes, it meant more African Americans could vote.O By defining citizenship, it meant all African Americans were entitled to due processBy banning slavery, it meant millions of African Americans were free from bondage. explain how Booker T. Washington being born a slave could have impacted his ideas on how to overcome racism. Please answer i really need to pick up my grade in math.Amany is planning a trip with her friends by renting a bus. She found that the bus costs $54.00 for 6 people. What is the cost per person? I need help with this poem called in this blind alley I have to come up with 5 examples PLZZZ HELP ME Which of the following is NOT a characteristic of plants?O Create food through photosynthesisO Multicellular organismsO Incapable of movementO Capable of moving by themselves To measure the amount of nickel in some industrial waste fluid, an analytical chemist adds 0.110 M sodium hydroxide (NaOH) solution to a 25.0 g sample of the fluid and collects the solid nickel(I) hydroxide (Ni (OH2) product. When no more Ni(OH)2 is produced, he filters, washes and weighs it, and finds that 343. mg has been produced The balanced chemical equation for the reaction is: Ni2+(aq) + 2NaOH(aq) Ni(OH)2(s) + 2 Na. What kind of reaction is this?a. precipitation b. acid-base c. redox How did the Patient Protection and Affordable Care Act fit the example of elastic clauseNesessary and proper clause? Under Mansa Musa's rule, the kingdom of Mali acollapsed when Sundiata took over bwent into the Dark Ages chad a Golden Age & doubled in size Plzzzzz help right answer gets a brainly! Two years ago, Jose bought $750 worth of stock in a cell phone company. Since then the value of his stock has been DECREASING at an average rate of 5 1/4 % per year. How much is the stock worth now? question in picture I WILL GIVE BRIANLIEST!!!!! PLS HELP WORTH 20 POINTS a person has gotten a new job with a much higher salary. he plans to spend his extra money on a new car and a great stereo system for his apartment. A patient asked a physical therapist to e-mail him some information on what other patients that he hastreated with the same injury have experienced. What should the therapist do? hihiii um ik the answer is 100 but i need the steps and im too lazy to even try :) [tex]2 log_{2}(x) + \frac{1}{2} log_{2}(x - 1) - log_{2}( x + 3) [/tex]solving these problem What connects the colon to the anus?AColon B Anus C Rectum D Biceps Bloodborne diseases cannot be transmitted by any other means thanneedlesticks.TRUEFALSE