A tabletop in the shape of a trapizoid has an area 8607 square centimeters. its longer base measures 123 centimeters, and the shorter base is 105 centimeters what is the height?​

Answers

Answer 1

Answer:

286.94 cm

Step-by-step explanation:

Data:

             Area = 8,607

             b1 = 105

             b2 = 123

      Area = 1/2 * (b1 + b2) * h

      h = 2 * Area/b1 + b2

      h = 2 * 8,607/105 + 123

     h = 286.94 cm

I'm not sure if it's right but that's what my calculator gave me.


Related Questions

PLEASE I NEED HELP CLICK ON THIS IMAGE

Answers

Answer:

There is no mode (B)

Step-by-step explanation:

SOMEONE PLEASE HELP!! I NEED TO GET THIS RIGHT

Answers

Answer:

middle

Step-by-step explanation:

What is the midpoint of the segment below? (-12, -3) (3, -8)

Answers

Your answer is: D.

(-9/2,-11/2) use the midpoint formula

What expression is equal to 5,007.992?

Answers

This is the answerrrrreerrrrre

Please help me ASAP
WILL MARK BRAINLY

3. When using the vertical method to multiply polynomials, your like terms must be lined up in what
rows
columns
descending order
ascending order

Answers

Answer:

column

Step-by-step explanation:

hope it will help you

Answer:

B. Columns

Step-by-step explanation:

-2(n+3)=13 help plz plz plz

Answers

First move the -2 to the other side
Since it is multiplying the brackets we do the opposite and divide 13 by -2
We now have n+3=6.5
Now to get n as the subject we do the opposite of plus 3 so we minus 3 from the other side
So n=3.5

Answer:

n = -9.5 or n = -19/2

Step-by-step explanation:

what is a single term algebraic expression is called?

Answers

An algebraic expression which consists of one non-zero term only is called a monomial. Examples of monomials: a is a monomial in one variable a.

Expression with one term is called a 'Monomial'

Expression with two unlike terms is called a 'Binomial'.
Expression with three unlike terms is called a 'Trinomial'.

X/23 = 21/34 round to hundredths place

Answers

Answer:

The answer is 14.19

Step-by-step explanation:

34 / 23 = 1.48

21 / 1.48 = 14.19

I hope this helps you! :D

The volume of a cube is 125cm3.
If the cube were ice blocks, how many cubes would you need make 1KL of ice?

Answers

Answer:

8000 cubes

Step-by-step explanation:

Given that 1KL is 1 Kilo liters

Then conversion of 1KL to cm³ => 1,000,000 cm³

Therefore, since we have a cube to be 125 cm³

Hence, to find the number of cubes of ice blocks that would make 1KL

We divide 1,000,000 cm³ from 125 cm³

=> 1,000,000 ÷ 125

=> 8,000

Therefore, the correct answer is 8,000 cubes

Erin bought 4 jars of jelly and 6 jars of peanut butter for $19.32. Adam bought 3 Jars of jelly
and 5 jars of peanut butter for $15.67.
Use x for jars of jelly and y for jars of peanut butter, write the equation for either Erin or Jack.
DO NOT SOLVE
(Worth 10 points)

Answers

Here is your system of equations in two variables.

Equation for Erin:

4x + 6y = 19.32

Equation for Adam:

3x + 5y = 15.67

That's it.

I will send a pic to you​

Answers

Answer:

agreed

Step-by-step explanation:

agreed...............................

ABCDEFGHIJKLMNOPQRSTUVWXYZ

this year you earned $75,500. Last year you earned $72,400. What was the rate of change on your earnings since last year
a. 4.28%
b. 4.68%
c. 4.92%
d. 5.12%​

Answers

5.12 I guess :)))))))

given the equation y = 2x - 8 what is the slope and the y-intercept​

Answers

Answer:

slope: 2

y intercept 0, -8

Slope is 2 and y-intercept is -8. This is because of the equation y=mx+b. M is slope and b is y intercept

A rectangular prism has a length of 3ft, a height of 6ft, and a width of 20ft. What is its
volume, in cubic ft?

Answers

Answer:

360

Step-by-step explanation:

To solve to volume you need to times the width, length, height. so 3 times 6 is 18 and 18 times 20 is 360.

In a survey of 300 college graduates, 53% reported that they entered a profession closely related to their college major. If 9 of those survey subjects are randomly selected with replacement for a follow-up survey, what is the probability that 3 of them entered a profession closely related to their college major

Answers

Answer:

0.1348 = 13.48% probability that 3 of them entered a profession closely related to their college major.

Step-by-step explanation:

For each graduate, there are only two possible outcomes. Either they entered a profession closely related to their college major, or they did not. The probability of a graduate entering a profession closely related to their college major is independent of other graduates. This, coupled with the fact that they are chosen with replacement, means that we use the binomial probability distribution to solve this question.

Binomial probability distribution

The binomial probability is the probability of exactly x successes on n repeated trials, and X can only have two outcomes.

[tex]P(X = x) = C_{n,x}.p^{x}.(1-p)^{n-x}[/tex]

In which [tex]C_{n,x}[/tex] is the number of different combinations of x objects from a set of n elements, given by the following formula.

[tex]C_{n,x} = \frac{n!}{x!(n-x)!}[/tex]

And p is the probability of X happening.

53% reported that they entered a profession closely related to their college major.

This means that [tex]p = 0.53[/tex]

9 of those survey subjects are randomly selected

This means that [tex]n = 9[/tex]

What is the probability that 3 of them entered a profession closely related to their college major?

This is P(X = 3).

[tex]P(X = x) = C_{n,x}.p^{x}.(1-p)^{n-x}[/tex]

[tex]P(X = 9) = C_{9,3}.(0.53)^{3}.(0.47)^{6} = 0.1348[/tex]

0.1348 = 13.48% probability that 3 of them entered a profession closely related to their college major.

Draw the line of reflection that reflects △ABC onto triangle Δ A'B'C'

Answers

Answer:

Step-by-step explanation:

Coordinates of the vertex A → (-4, -6)

Coordinates of the vertex A' → (6, 6)

Since, y-coordinates are same opposite in notation,

Therefore, by the rule of reflection, line of reflection will be a line parallel to y-axis.

And points A and A' will be equidistant from the line of reflection.

Midpoint between A and A' = [tex](\frac{x_1+x_2}{2},\frac{y_1+y_2}{2})[/tex]

                                              = [tex](\frac{-4+6}{2},\frac{-6+6}{2})[/tex]

                                              = (1, 0)

Therefore, x = 1 will be the line of reflection.

A 90 ounce bag of nuts has cashews and peanuts in it. The peanuts weight is 10 more than 3
times the weight of the cashews. Find the weight of the cashews and peanuts.

Answers

Answer:

20 ounces of cashews and 70 ounces of peanuts

Step-by-step explanation:

x+3x+10=90

4x+10=90

4x=80

x=20

a quadratic patterns has a second term equal to 1,a third term equal to -6 and fifth term equal to -14 .hence or otherwise calculate the first term of the pattern​

Answers

Answer:

first term of the pattern​ (T₁) : 10

Step-by-step explanation:

T₁  ;    1 ;    -6 ;   T₄ ;    -14  

1-T₁  ;  -6-1   ; T₄-(-6)  ; -14 -T₄    (First Tₙ-Tₙ₋₁)

-8+T₁  = T₄+13 = -2T₄-20            (2nd Tₙ-Tₙ₋₁ is constant)

T₄+13 = -2T₄-20          3T₄ = -33          T₄ = -11

-8+T₁  = T₄+13         -8 + T₁ = -11 + 13 = 2

T₁ = 10

thank you to whoever helps

Answers

(3,1) would be the right answer

Johnny had 600 red apples and 400 blue oranges, then his friend gave him 20 red bananas. He eats all of the bananas, throws away 200 of the blue oranges because he couldn't finish them all, and he fed 100 of the red oranges to his pet rock. How many pumpkin pies does he have now?

Answer choices:
8,000,000
No, he has 6000 bananas
I think he just ordered some offline
He has 300 red apples

Answers

Answer:

4 im not sure

Step-by-step explanation:

Question 8 I don’t get

Answers

Answer:

Y=4x

Y is total profita

X is how many she sells

Hey guys I need some help; I would really appreciate it :)

Answers

Their answer is correct so you need explanation?

What is radiant energy from the sun called

Answers

Answer:

Solar rays

Step-by-step explanation:

Either that or uv rays

Answer:

Electromagnetic Radiation

Step-by-step explanation:




4. Patti and her friends want to see one of
two movies. One movie starts in 1 day
2 hours 20 minutes. The other movie
starts in 1 day 4 hours 10 minutes. The
later movie starts at 5:00 P.M. At what
time does the earlier movie start?

Answers

Answer:

The earlier movie starts at 1610 (4:10 PM)

Step-by-step explanation:

The later movie starts at 1700 (5:00 PM), and is in 1 day, 4 hours and 10 minutes. That means the time is __:50. Additionally, it's in 4 hours. 1700 - 400 = 1300 (1:00 PM). Now we know the time is 1350 (1:50 PM) presently.

If it's currently 1:50 PM, and the earlier movie starts 2 hours from this time tomorrow, then it begins at 1350 + 200 = 1550 (3:50PM). Take into account that there's also another 20 minutes before the movie commences, it will be 1610 (4:10 PM).

Good luck!!

State if the triangles in each pair of similar. If so, state how you know they are similar and complete the similarity statement.


triangle UTS~ ____

a. similar, AA, UED
b. similar, SSS, UDE
c. similar, SAS, UDE
d. not similar​

Answers

Answer:

triangle UTS~∆UED by AAA axiom

Find the surface area of a cone that has a slant height of 6 inches and a base with a diameter of 3 inches.

Answers

Answer:

Step-by-step explanation:

radius r = 1.5 in

slant height ℓ = 6 in

lateral area LA = πrℓ

                     = π(1.5)(1.5)

                     = 2.25π

                  ≅ 7.07 in²

base area BA = πr²

                    = π1.5²

                  ≅ 7.07 in²

 

surface area SA = LA + BA

                       = 7.07 + 7.07

                  ≅ 14.14 in²

The lateral surface area is _ square centimeters.

Answers

Answer: 24

Step-by-step explanation:

write the equation of a line parallel to y=3/2x-4 and has a Y intercept of -3

Answers

Answer:

one sec

Line that is parallel:

Step-by-step explanation:

Buffer stock is the level of stock ​

Answers

Answer:

akuy3uwujwu

Step-by-step explanation:

uwoedihwo

Answer:

Safety stock inventory, sometimes called buffer stock, is the level of extra stock that is maintained to mitigate risk of run-out for raw materials or finished goods due to uncertainties in supply or demand.

HOPE IT HELPS...

HAVE A GREAT DAY : P

Which is greater 1.56 or 1.29

Answers

Answer:

1.56 is greater than 1.29. (Check after the decimal point, 5 is greater than 2, so 1.56 is greater than 1.29)

Answer:

I believe that 1.56 is grater than 1.29.

hope this helps.

Other Questions
Write the sentence as a proportion: 4 wins in 7 games is the same as 116 wins in 203 games. In his free time, Gary spends 11 hours per week on the Internet and 8 hours per week playing video games. If Gary has five hours of free time per day, approximately what percent of his free time is spent on the Internet and playing video games? n the railroad accident, a boxcar weighting 200 kN and traveling at 3 m/s on horizontal track slams into a stationary caboose weighting 400 kN. The collision connects the caboose to the car, and then both move together and you have found the final velocity. Apparently, initial kinetic energy of the system changes (in part, because of friction present). How much energy (in kJ) is transferred from kinetic energy to other forms of energy (e..g., thermal) in the collision In a family with parents who do not have hemophilia, one son has hemophilia. Who was the carrier of the gene for hemophilia?*if possible, I also need a Punnett square * __C+_SO2_CS2 + __CO Which ecosystem would be affected the most by losing its butterflies, and why? A. Ecosystem 2 because it has more kinds of plants, animals, and insects. B. Ecosystem 1 because it has more plants that depend on the butterfly. C. Ecosystem 2 because it has more insects that compete with the butterfly. D. Ecosystem 1 because it has fewer kinds of plants, animals, and insects. 15% of 20 is ??? please helpp What is the distance between (3,7) and (-3,-1) ? 1) How many organs of central government are there? Name them A uniform electric field exists in a region between two oppositely charged plates. An electron is released from rest at the surface of the negatively charged plate and strikes the surface of the opposite plate, 2.0 cm away, in a time 1.5 x 10-8 s. The speed of the electron in millions m/sec as it strikes the second plate is: A. 13.3 B. 133 C. 2.67 D. 26.7 E. 534 In the late1890s, who created a support system to help African American businesses? Jim Crow Pat McCrory W.C. Coleman A.M. Waddell Please Help ASAP before midnight. Write a unit rate for the situation.$12.50 for 5 ouncesAlso if you can, with your answer can you tell me how to find unit rate? A pyramid with an equilateral-triangle base has a volume of 48sqrt{3} cm3 and a height of 16 cm. Find the length of each side of the equilateral triangle.You get brainliest, i need answers fast. How was religion in ancient Rome similar to religion in ancient Greece? (Choose 3)ARoman gods had the same names.BRoman gods had human-like qualities.CRoman religion was polytheistic.DRoman gods were different aspects of one God.ERoman religion included a holiday called Saturnalia.FRoman gods played an important role in everyday life by protecting families, homes, farms and even animals. Rewrite the number in Standard form6 x 10^8 What is the main source of winds and weather? A. The spinning EarthB. The Earth's rotation on its axisC. The layers of the planetD. The sunI will mark correct answer brainliest 3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA