A student has a test tube that contains 50 mL of water. She wants to add a substance to the water that will cause the test tube to become hot to the touch. Which of the following would be best for her to add to the water?
A.
a substance that produces a gas when it reacts with water
B.
a substance that does not react with water
C.
a substance that releases heat when it reacts with water
D.
a substance that absorbs heat when it reacts with water

Answers

Answer 1

Answer:

the guy above is wrong the actual answer is C

Explanation:

Answer 2

The best for a student to add to the water is a substance that releases heat when it reacts with water. Thus, the correct option is C.

What is an exothermic reaction?

When a chemical reaction takes place, energy is transferred to or from the surrounding in the universe. When the energy is transferred to the surrounding, there is a loss of energy, this reaction is called an exothermic reaction, and the temperature of the surrounding increases during this reaction.

The process of dissolving a substance is exothermic when more energy is released when water molecules bond to the solute particles in the solution than is used to break the solute particles apart. Because, more energy is released than is used in this process, the molecules which are present in the solution move faster, and thus results in an overall increase in temperature.

Therefore, the correct option is C.

Learn more about Solutions here:

https://brainly.com/question/7932885

#SPJ2


Related Questions

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

Why does an atom have a neutral charge?
A. It has equal numbers of electrons and neutrons.
B. The number of neutrons equals the number of protons and
electrons in the atom.
C. It has equal numbers of electrons and protons.
D. It has equal numbers of neutrons and protons.

ITS C

Answers

Then answer is letter C

A planet has less mass than a galaxy and more mass than the star it orbits.
True
False

Answers

Answer:

False is your answer

The climate influences ________
A. Plant growth
B. Biodiversity
C. Adaptions of land organisms
D. All of the above

Answers

Answer:

D

Explanation:

Please help.................

Answers

Answer:

C i think.......................................

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

What is another type of clean energy?

Answers

wind energy is a clean energy source


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

What is meant by trophic levels?

Answers

Answer:

The position it holds in the food chain

Explanation:

A food chain is a succession of organisms that eat other organisms and may, in turn, be eaten themselves.

Why do multicellular organisms perform mitosis and meiosis ?

Answers

Answer:

Multicellular organisms depend on mitosis for growth and repair. When an animal, plant or other multicellular organism grows, it makes more cells through mitosis. Organisms can repair some of their tissues, using mitosis to regenerate new cells.

Explanation:

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

is planting trees in a forest In an investigation into the role of plants in the cycling of matter, a researcher is designing an experiment in which plants will be grown under conditions that will limit the rate of photosynthesis. Which design would match the goal of the researcher? M. Grow the plants in a low oxygen environment and measure the rate of carbon dioxide production. P. Grow the plants in a low carbon dioxide environment and measure the rate of oxygen production. R. Grow the plants in soil containing excess water and measure the rate of transpiration. S. Grow the plants in soil containing excess nitrogen and measure the rate of plant growth. Bi​

Answers

Answer:

S

Explanation:

The growth of plant can be measured using the starch produced.

A man and a woman have a child together. The mother's blood type is type O and the child's blood type is type A What could the father's genotype be?

Answers

Answer:

iAiA or iAi = Type A

Explanation:

Blood group in humans is controlled by a gene with multiple alleles. The alleles iA and iB are co-dominant over one another but dominant over allele i. In the blood type:

iAiA or iAi - type A

iBiB or iBi - type B

iAiB - type AB

ii - type O

According to this question, a man and a woman have a child together. The mother's blood type is type O (ii) and the child's blood type is type A (iAi). This means that the father's blood type must be a type A with genotype "iAiA or iAi".

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

The transfer of pollen from one flower to another flower on the same plant is known as​

Answers

Answer:

Cross-pollination.............

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a mutation appear in the phenotype of an individual

Answers

Some mutations don't have any noticeable effect on the phenotype of an organism. This can happen in many situations: perhaps the mutation occurs in a stretch of DNA with no function, or perhaps the mutation occurs in a protein-coding region, but ends up not affecting the amino acid sequence of the protein

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

What are mutations?

Mutations refers to the changes that occur in the DNA of an individual organism. These chages may or may not change the appearance (phenotype) of the orgamsim.

The type of mutation which may not result in any chage to the penotype of an organsim is called a silent mutation.

Learn more about mutation:https://brainly.com/question/365923

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

i need help with #8, #10 please! whoever helps me, ill give brainliest <3

Answers


1. peripheral nervous system
2. synapse
3.nerve impulse

Please can anyone help me in question 2&3

Answers

Answer:

2. Reflex action ( transmitting of nerve impulse)

3.Excitory

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

pollination of a flower or plant with pollen from a different flower or plant is known as​

Answers

Answer:

Cross-pollination

Explanation:

cross-pollination is when pollen from one plant gets transported to another plant.

self-pollination is when pollen gets transported from the anther to the stigma of the same flower or a different flower on the same plant.

Other Questions
1. The graphs below represent functions defined by polynomials. For which function are the zeros of thepolynomials 2 and - 3? In Phoenix, Arizona, the average temperature is 85 degrees Fahrenheit or higher during 25% of the year. During about how many weeks of the year is the average temperature below 85 degrees Fahrenheit? You invested $600 in a savings account that earns simple interest. After 20 years the account had earned $720 in interest. What was the interest rate on the account? Your answer can be in decimal or percent form. Where does 8\10 go on a splited number line please please my dyslexia is a pain. loolllllllll i neeeddd helpppp asapppppppp The Albertsons are purchasing a home for $400,000. They are financing 70 percent of the home's value. In addition to the down payment, they have the following closing costs: Lender's inspection fee $400 Loan origination fee 1.5% of the loan amount Notary public fee $60 Document recording fees $75Title search $300 What is the total amount of the closing costs? .help plz CO Use the following coordinate plane to write the ordered pair for each point During the first week of registration, 35 people signed up for the Health Fair 5K and FunRun. The next week, 28 more people signed up. On the day of the race, 12 runners did notshow up. However, at the last minute 16 people came in for late registration. Whichexpression shows how many people ran in the 5K and Fun Run what is the mode for the following numbers 67 76 67 76 67 23 32 23 32 Why is color NOT the best property to identify minerals A) different minerals can have the exact same colors B) all minerals have the same streak C) color can change due to impurities D) all minerals have one type of element HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAP Which of the following types of cells have cell walls?A. Red Blood CellB. Nerve CellC. Cork CellD. Animal Cells Please help. (science question) solve 15=2y - 5 (for homework) Some parents will drive 17 children to summer camp. Each parent can fit 4 children in a car.What is the fewest number of parents needed to drive all the children? where did farmers get their money in 1935? pls answer me this all question correctly pls What rights are protectedin most democracies?t 2) 24, 12, 10, 15, 10, 22, 12 mean: _________ median: _________ mode: ________ range: ________