A state university annual report showed that its retention rate was at 24% and university administrators would like to increase this rate. After implementing several new programs during the last two years, the university reevaluated its retention rate. What is the correct alternative hypotheses for a test to determine whether the retention rate has increased during the last two years

Answers

Answer 1

Answer:

the alternative hypothesis is - p > 0.24

Step-by-step explanation:

Given that the retention rate is 24% = 0.24

So,

The alternative hypothesis is -

p > 0.24

Because the retention rate has increased during the last two years.


Related Questions

Find all factors of the given number. (Enter your answers as a comma-separated list.)
200

Answers

All factors would be:

1, 2, 4, 5, 8, 10, 20, 25, 40, 50, 100, 200

Find the solution of the system of equations.
-2x - 9y = -3
--7x - 9y = -33

Answers

Answer:

x = 6 and y = -1

Step-by-step explanation:

hope this helps

Answer:

x= 6 and y= -1

Step-by-step explanation:

-2x - 9y = -3

-7x - 9y = -33

I'm going to be solving by elimination. However, you can solve using substitution as well.

So the first step is to eliminate one of the variables. In my opinion, what's easiest is eliminating the y variables. To eliminate you want to variables (that are the same) to equal 0 and cancel out. To do this, all I have to do is subtract. When I subtract I get 0 as shown below. I will also subtract the other variables and numbers in the equations because that's how elimination works.

-2x - 9y = -3

-7x - 9y = -33

5x = 30

-2 - (-7)=5 and -3 - (-33)= 30

There's no solution for the y variable because -9 - (-9)=0, which cancels out so it doesn't have to be written.

after that you get x=6 because you divide by 5 on both sides.

All that's left is to plug in 6 to one of the equations:

-2(6) - 9y= -3

-12 - 9y= -3

+12         +12

-9y= 9

Divide both sides by -9 to get y= -1

I Need Help ;-; pls its timed

A rectangle is shown on a coordinate plane with vertices A(Negative 4, 8), B(1, 8), C(1, Negative 1), and D(Negative 4, Negative 1).

On a coordinate plane, a rectangle has 4 points. Point A is (negative 4, 8), point B is (1, 8), point C is (1, negative 1), point D is (negative 4, negative 1).

What are the dimensions of the rectangle?
The base is 4 units and the height is 9 units.
The base is 5 units and the height is 7 units.
The base is 5 units and the height is 9 units.
The base is 9 units and the height is 3 units.

Answers

Answer:

The correct answer is the third option

Step-by-step explanation:

I used a graphing calculator and also did L(W). But, the length (height) was 9 and (base) width 5

please help ill give brainly !! (no links)

Alfred Weagner noticed that the outline of many continents fit together, much like a puzzle leading him to propose the idea of a single super continental. This continental is known as-

A ) Eurasia
B ) Ind-Australia
C ) America
D ) Pangaea

Answers

Answer:

This continental is known as-

D) Pangaea

Answer:

choice D ) Pangaea

How much money is 5 dollars, 10 dimes, and 10 pennies?

Answers

Answer:

6 dollars and 10 cents

Step-by-step explanation:

I'm sorry this isn't the answer, but I just want you to know that you are incredible and that I love you for you! You are special to everyone you meet, and should not change who you are. I know your life may be tough, but you are strong and can get through it!

Don’t waste an answer if you ain’t gonna help :)

Answers

the answer is that y=13

What is m∠G to the nearest tenth?

Answers

Answer:

Step-by-step explanation:

tan(G) = 28.2/45.8

G = arctan(28.2/45.8) = 31.6°

here u go! BWABWABWABWABWA

Answers

Answer:

- 100

Step-by-step explanation:

Take 10 from both sides

t/2 + 10 - 10 = -40 - 10      Combine like terms

t/2 = - 50                          Multiply both sides by 2

2*t/2 = -50*2

t = - 100

Answer:

= (-90)

Step-by-step explanation:

-90/2+10=. -80/2

2 will go into -80 ,-40 times

What is the area of triangle BCD to the nearest tenth of a square centimeter? Use special right triangles to
help find the height. Show your work.

Answers

Answer:

Area = 13.8 cm²

Step-by-step explanation:

Area of a triangle = ½*base*height

base = 4 cm

height = ?

Find height using trigonometry function:

Reference angle = 60°

Opp = height = BC

Adj = 4 cm

Apply TOA:

Tan 60 = Opp/Adj

Tan 60 = BC/4

BC = 4*Tan 60

BC = 6.92820324 ≈ 6.9 cm

✔️Area of triangle = ½*4*6.9

= 13.8 cm²

72,-36,18,-9 find the common ratio​

Answers

I’m not sure about the answer but there is app called Socratic can help you out

Help me I have this due today!!!

Answers

Answer:

The answer is 21/25.

Step-by-step explanation:

I hope this helps! Have a great rest of your day!

Jerneii writes the set of ordered pairs below. The set represents a function.
{(3,-3), (5,0), (-1, 4), (-6, 7)}
Jerneii claims that she can add any point to the set and have the set still represent a function.
Which of the following points can be used to show that Jerneii's claim is incorrect?
O(-6, 1)
O (9,8)
O (0,5)
O (1,7)

Answers

Answer:

WOMP WOMP WOMP!!!

Step-by-step explanation:

If the base area of a cylinder is 176.625
square centimeters and the height is 3.5
centimeters, determine the volume of the
cylinder

Answers

Answer:

618.1875 cm^3

Step-by-step explanation:

Volume = base area x height, so 176.625 x 3.5 = 618.1875

help me pls pls pls PPPPPPPPPPPPPPPLLLLLLLLLLLLLLLLSSSSSSSSSSSSSSSSS

Answers

Required area = 9× 5 + 6×3

= 45+18

= 63

The correct answer is 75+ 18 which is equal to 93

Matthew bought flowers for his mother. Exactly 1/4 of the roses were white. How many roses were white?

Answers

Answer:

1/4

Step-by-step explanation:

jdkdbejenrdjeiuidur

Which table shows a linear function?
-4
- 1
1
2
3
у
8
2
2
4
6
-16
-8
х
-6
-2
0
1
3
-2.
2
y
0
-2

Answers

It’s 12 units long I
Hope it the answer just trying to help

Please help I’ll mark you brainliest

Answers

Answer:

The perimeter is 25.

Step-by-step explanation:

Darling, I'm not always accurate but I hope this helps you with math!

A researcher recorded the number of e-mails received in a month and the number of online purchases made during that month for 50 people with an online presence. The resulting data were used to conduct a hypothesis test to investigate whether the slope of the population regression line relating number of e-mails received to number of online purchases is positive. What are the correct hypotheses for the test?

a. H0:β1=0Ha:β1≠0

b. H0:β1=0Ha:β1>0

c. H0:β1=0Ha:β1<0

d. H0:β1>0Ha:β1=0

e. H0:b1=0Ha:b1≠0

Answers

Answer:

B

Step-by-step explanation:

College Board

hi can you please help me with my work and please no Link please no Link please​

Answers

Answer:

The second one, -11/12

Step-by-step explanation:

I used a website so sorry I don't have an explanation

Please help, This is due at 5 pm
Question 1(Multiple Choice Worth 4 points)
(07.01)
Which of the values in the set {2, 3, 4, 5} is a solution to the equation 2x + 4 = 10?

2
3
4
5
Question 2(Multiple Choice Worth 4 points)
(07.01)
Geoffrey is trying to earn $50 to buy a video game. He has saved $14.25. He earns $3.75 per hour cleaning windows with his uncle and he earns $6.50 per hour working at the grocery store. Can Fred buy the video game if he works with his uncle for 3 hours and at the grocery store for 4 hours? Use the inequality 3.75y + 6.50z + 14.25 ≥ 50.

Yes, because the total will be $51.50.
Yes, because the total will be $60.25.
No, because the total will be $24.50.
No, because the total will be $37.25.
Question 3 (True/False Worth 4 points)
(07.01)
True or False?
k = 3 over 4 is a solution to the inequality 12k + 2 < 12.

True
False
Question 4(Multiple Choice Worth 4 points)
(07.01)
Which of the values for x and y make the equation 3x + 4y + 6 = 26 true?

x = 4, y = 2
x = 5, y = 6
x = 4, y = 3
x = 3, y = 5
Question 5(Multiple Choice Worth 4 points)
(07.01)
Which of the following sets shows all the numbers from the set {1, 2.5, 3, 4.5, 5} that make the inequality 3a + 4 ≥ 13 true?

{2.5, 3, 4.5}
{1, 2.5}
{3, 4.5, 5}
{4.5, 5}

Answers

Answer:

Step-by-step explanation:

1) 2x+ 4 = 10

2x = 6

x = 3 (3 is the answer)

2) we have to substitute y with 3 and z with 4

3.75*3 + 6.50*4 ≥ 50

11,25 + 26 ≥ 50

37.25 ≥ 50

so the answer is no, because the total will be $37.25

3)  12k + 2 < 12

12k < 10

k < 5/6

3/4 < 5/6  so the answer is true

4) we have to try the options

a)  3*4 + 4*2 + 6 = 26

12 + 8 + 6 = 26

26 = 26 (true)

b) 3*5 + 4*6 + 6 = 26

15 + 24 + 6 = 26

45 = 26 (false)

c) 3*4 + 4*3 + 6 = 26

12 + 12 + 6 = 26

30 = 26 (false)

d) 3*3 +4*5 + 6 = 26

9 + 20 + 6 = 26

35 = 26 (false)

so the answer is x=4 , y=2

5) 3a + 4 ≥ 13

3a ≥ 9

a ≥ 3

so the answer is {3,4.5,5}

You wonder if weather (rain, cloudy or sunny) makes a difference on mood (happy or not). To determine this, you sample the moods of 200 people on a sunny day, 200 people on a rainy day and 200 people on a cloudy day and record whether they were happy or not. You then want to do a chi square test on this data. What are the degrees of freedom?

Answers

Answer:

2

Step-by-step explanation:

Drawing a table to show the different weather and mood options :

The degree of freedom :

________ WEATHER ________

__________Rain ____ sunny _____ cloudy

Happy

|

Not happy

Here, we have a contingency table formatted in rows and columns

The columns = 3

The rows = 2

Degree of freedom :

(rows - 1) * ( columns - 1)

(2 - 1) * (3 - 1)

1 * 2

= 2

The degree of freedom = 2

5. a) Which figure is the mapping diagram of the relation
shown?

b) is the relation a function

Please help

Answers

Answer:

b, since the others have the input and output on the wrong sides

The answer will be B :)

In circle A measure of arc BD-56' and BC is a diameter. Which statements are correct?

Answers

The answer is quiet clear I done he snaisknsnridnd

Answer:

90 degrees and 80 degrees

If F(x) = x - 5 and G(x) = x2, what is G(F(x))?

Answers

Answer:Step-by-step explanation:

G(F(x))=(x - 5)²

Match the values with the statistical measures for these data points.

20, 20, 21, 22, 23, 23, 24, 24, 25, 25, 26, 26

Answers

Answer:

20, 20, 21, 22, 23, 23, 24, 24, 25, 25, 26, 26

Step-by-step explanation:

median (middle number) is (23 + 24) / 2 = 47/2 = 23.5 <== median

Q1 = (21 + 22) / 2 = 43/2 = 21.5 <== lower quartile

Q3 = (25 + 25) / 2 = 50/2 = 25 <== upper quartile

Your welcome! (Please correct me if im wrong!)

Please mark brainiest

Write 3 equivalent ratios for each ratio given.
6.25 to 1.25

Answers

Answer:

3 equivalent ratios are: [tex]\frac{62.5}{12.5}, \frac{625}{125}, 5[/tex]

Step-by-step explanation:

Ratio of a to b:

The ratio of a to b is given by:

[tex]\frac{a}{b}[/tex]

Finding equivalent ratios:

To find equivalent ratios, we multiply or divide both a and b by the same value.

6.25 to 1.25

[tex]\frac{6.25}{1.25}*\frac{10}{10} = \frac{6.25*10}{1.25*10} = \frac{62.5}{12.5}[/tex]

[tex]\frac{6.25}{1.25}*\frac{100}{100} = \frac{6.25*100}{1.25*100} = \frac{625}{125}[/tex]

[tex]\frac{\frac{6.25}{1.25}}{{\frac{1.25}{1.25}}} = 5[/tex]

3 equivalent ratios are: [tex]\frac{62.5}{12.5}, \frac{625}{125}, 5[/tex]

A positive angle less than 360 that is coterminal with -725 degrees is

Answers

The angles number would be 230

The positive angle is less than 360 which is coterminal with -725 degrees is  85 degrees.

What are Coterminal Angles?

Coterminal angles are those with the same beginning side and the same terminal sides. These angles are in the typical position, although their values differ. They have the same sides, are in the same quadrant, and their vertices are identical. The endpoint sides coincide at the same angle when the angles are rotated clockwise or anticlockwise.

An angle that is coterminal with -725 degrees is an angle that has the same initial and terminal sides as -725 degrees, but its measure is between 0 and 360 degrees.

To determine a positive angle less than 360 that is coterminal with -725 degrees, we can add or subtract multiples of 360 from -725 degrees until we get an angle within that range.

In this case, -725 degrees - (2 x 360) = -725-720= -1445.

So, the positive angle less than 360 that is coterminal with -725 degrees is -1445 degrees + 360 = 85 degrees.

To learn more about Coterminal Angles click here:

https://brainly.com/question/23093580

#SPJ2

help please, asap. i need this done

Answers

Answer:

2

Step-by-step explanation:

15/3=5

25/5 = 5

10/2 = 5

Answer:

2

Step-by-step explanation:

You have to find the "pattern."

for 15 and 3, you have to divide 15 by 5 and thats 3.

for 25 and 5, 25/5 is 5, so 10/5 is 2.

If 8 containers of yogurt cost $6.80, how many containers of yogurt can you purchase
with $11.05?
You can purchase
containers ? yogurt with $11.05.

Answers

Answer:

The answer is 13 containers of yogurt.

Step-by-step explanation:

$0.85 = 1 container of yogurt so if you multiply 0.85 * 13 you will have your answer. I know this isn't too good of an explanation but trust me.

HELPPPPPPP PLEASE AND BRAINLY STOP ASKING ME TO WRITE MORE IM IN URGENCY

Answers

Answer: 1,431

Step-by-step explanation:

split the thing into two rectangular prisms

small prism dimensions: 18 x 2 x 3

multiply the dimensions to get 108

large prism dimensions: 7 x 21 x 9

multiply the dimensions to get 1,323

add 1,323 and 108 together to get 1,431

Other Questions
An obstacle to sustainable development is the growth of ecotourism increasing reliance on fossil fuels negative population growth in developed countries farm to table restaurants decrease mass consumption If angle 3 is 4x+1 and angle 4 is 7X+3. what are the measures of angle 3 and 4? Which of the following is NOT a benefit of fitness walking?O Improves your visionO Strengthens your hearto Improves self-image and releases stressO Can be done anywhere, in any weather When identifying properties of n - sided polygons where 3 _< n Choose the correct simplification of the expression a^9 multiplied by b^10/a^2 multiplied by b^7A^11b^171/a^11b^171/a^7b^3A^7b^3 Suppose you invest money in two accounts. One of the accounts pays 4% interest annually, andthe other account pays 5% interest annually. You have $ 2000 more invested in the account paying4% than in the account paying 5%. How much do you have invested in the account paying 4% ifyou earn $ 670 interest in a year? Fill two Zip Loc bags half full of water. Put food coloring in both bags. Zip both bags. Tape one bag to a sunny window. Tape the other bag to a shady window. After 30 minutes, observe the bags to see which one changed the most. The purpose of the directions above is to OA. describe the results of a safe science experiment OB. entertain the reader with a game of plastic bags. OC. describe the process for a science experiment. OD. persuade the reader to use a certain kind of bag. What belief system was endorsed by the state that ruled the holy land in 550 CE 3. What organ(s) did Jason donate to Ronald Griffin? HELP DUE IN 10 MINS!mWXZ =?? sub (7x+5)(2x28x+6). The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle How does Jacob Riis allow this transition to happen smoothly A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates. "Master", I said "this sayings had for me."This sentence primarily reflects the role ofA. Dante as PilgrimB. Dante as PoetC. Virgil as guideD. Virgil as teacher Suri makes $15 per hour and gets a weekly bonus of $25. Juan makes $14 per hour and gets a weekly bonus of $50. Is it possible for Suri and Juan to makethe same amount of wages, y, by working the same number of hours, x, in one week?O Yes, because the slopes of the equations are different so the system of equations will have one solution.No, because the slopes of the equations are different so the system of equations will have no solutions.O Yes, because the slopes of the equations are the same so the system of equations will have infinitely many solutions.No, because the slopes of the equations are the same so the system of equations will have no solutions. The area of a rectangle is 20 mm2. If the width is 4 mm, find the length?