A couple has just learned their neonate is diagnosed with osteogenesis imperfecta, and they
ask, "What caused our child to get this disease?" What should the health care provider teach
the couple about their neonate's condition?

Answers

Answer 1

Answer:

osteogenesis imperfecta is an inherited genetic disease that mainly affects the bones.  

Explanation:

Osteogenesis imperfecta is an inherited genetic disease associated with alterations in collagen synthesis, which have been shown to increase the risk to suffer bone fractures. This genetic disorder is characterized by different health problems including, among others, fragile bones, reduced skeletal mass, skin hyperlaxity, malformations in the central nervous system, etc. Clinically, osteogenesis imperfecta must be managed by an interdisciplinary medical team, since patients may present a clinical picture ranging from mild to lethal. In the first place, it is imperative to provide health care to avoid fractures, exercises to maintain muscle mass, exercise to improve motor skills, skincare by specialized dermatologists, etc.

Answer 2

The disease 'osteogenesis imperfecta' is caused by the neonate inheriting it

from either of the parent because it's a genetic disorder. The health care

provider should teach the parent about how to prevent the effect of having

such disease such as bone fractures.

Osteogenesis imperfecta is a genetic disorder inherited by offspring from

their parent. The disease involves individuals having very  brittle bones which are easily broken. The nurse should teach the parent to adopt bone strengthening steps such as adequate calcium intake and physiotherapy.

Read more on https://brainly.com/question/23578140


Related Questions

Help with this please anyone!!!

Answers

Answer:

top right

Explanation:

What is an example of nature exhibiting zero
waste?
1. Oxygen is a waste product
from plants.
2. Oxygen is a waste product
from animals
3. Animals consume oxygen in
respiration
4. Plants consume oxygen in
photosynthesis
A
1 and 3
B
1 and 4
С
2 and 3
D
2 and 4

Answers

Answer:

idontknow

Explanation:

you are aintelligent nice qiestion

RNA polymerase is an enzyme that copies (1 point)
o DNA into DNA.
O RNA into mRNA
O mRNA into tRNA.
DNA into RNA

Answers

Answer:Copies DNA into RNA

Explanation:

all of the following are examples of organic matter soil except

Answers

This question is incomplete; here is the complete question:

All of the following are examples of organic matter soil except

A. Decaying plants

B. Bacteria

C. Fungi

D. Water

The answer to this question is D. Water

Explanation:

Organic matter derives from living beings, due to this, organic matter is considered as a biological product. In this context, materials such as decaying plants are organic matter because they derive from living organisms and contain biological molecules (most contain carbon). This category does not apply to water, which is composed of hydrogen and oxygen and does not derive from living beings. Thus, the one that is not organic matter is water.

Answer:

D. Water

Hope this Helps!! :))

Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria

Answers

Answer:

DNA

Explanation:

cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.

Answer:

A- DNA

Explanation:

Epithelial tissue always has an exposed outer surface and an inner surface anchored to connective tissue by a thin, non- cellular structure called the (a) Nonstratified layer (b) Stratified layer (c) Basement membrane (d) Fibroblast

Answers

Explanation:

(a)Nonstratified layer

Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)

Answers

Answer:

The correct answer is C. All light tan        

Explanation:

You will find the answer and explanation in the attached file due to technical problems.

as you read through the research in case study: sea turtles, keep in mind the three basic steps of addressing challenges to ecological well-being. answer these three questions as you review the information on the everglades

Answers

Three question that are missing from given question are as follows:

Identify the problem(s) at hand.

Determine the cause of the problem(s).

Recommend solutions to the problem(s).

Answer:

The nesting area of ocean turtles could be saved and secured with the assistance of commitment of neighborhood individuals , maintaining a strategic distance from of beach fires during nesting season. Leave the enough beach area for the turtles to hatch their egg and nesting.

There ought to be negligible lighting close to the settling regions as arched turtles are attracted to light and they may wind up moving towards the city as opposed to the water. Local people could protect the hatching eggs from other wild creatures and winged animals by tagging them and keeping a nearby eye.  

Beach region should be cleanup as the debri are the significant reason forever danger to the turtles and all other marine creatures.  

How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.

Answers

Answer:

The correct answer is - option B. They are small because they lack a nucleus.

Explanation:

Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.

In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.

Thus, the correct answer is : option B. They are small because they lack a nucleus.

In a population of flowers growing in a meadow, C1 and C2 are autosomal codominant alleles that control flower color. The alleles are polymorphic in the population, with f (C1) = 0.8 and f (C2) = 0.2. Flowers that are C1C1 are yellow, orange flowers are C1C2, and C2C2 flowers are red. A storm blows a new species of hungry insects into the meadow, and they begin to eat yellow and orange flowers but not red flowers. The predation exerts strong natural selection on the flower population, resulting in relative fitness values of C1C1 = 0.30, C1C2 = 0.60, and C2C2 = 1.0.

Required:
a. What is the C1C2 genotype frequency among the progeny of predation survivors?
b. What is the C2C2 genotype frequency among the progeny of predation survivors?
c. What is the C2C2 genotype frequency among the progeny of predation survivors?
d. What is the equilibrium C2 allele frequency in the predation environment?

Answers

B is yours answer have a nice day

Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome

Answers

Answer:

The correct answer is B

Explanation:

Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.

A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.

Many inherited human diseases such as cancer are related to Alu insertions.

Cheers!

Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.​

Answers

Answer:

A

Explanation:

Took test on Edge.

Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.

What is MSDS?

Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.

Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.

Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.

Learn more about MSDS here:

https://brainly.com/question/3282390

#SPJ6

Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?

Answers

Answer:

Due to optimum environment for microbes.

Explanation:

I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.

Drag each tile to the correct location.
Sort the descriptions based on whether they are related to asexual reproduction or sexual reproduction.
creates genetically
unique offspring
creates genetically
identical offspring
organism doesn’t have to
waste energy to find a
mate
organism needs time to
reach adulthood to
reproduce
requires the contribution
of two parents

requires the contribution
of a single parent

Answers

Answer:

SEXUAL REPRODUCTION:

-creates genetically unique offspring

-organism needs time to reach adulthood to reproduce

-requires the contribution of two parents

ASEXUAL REPRODUCTION:

-creates genetically identical offspring

-organism doesn’t have to waste energy to find a mate

-requires the contribution of a single parent

Explanation:

Living organisms employ two types of reproduction to produce their offsprings. They are sexual reproduction and asexual reproduction.

Sexual reproduction is that reproduction involving the fusion of two sex cells from opposite sex individuals i.e. male and female. Sexual reproduction forms offsprings with unique genetic contents, which is as result of the meiotic process that each individual organism undergoes to produce gametes or sex cells (sperm and eggs). Since there must be a fusion of gametic cells, sexual reproduction requires the contribution of two parents (a male and a female). Also, the parents only undergo meiosis to produce gametes at certain points in their life. Hence, they have to wait to reach adulthood to do that.

On the other hand, asexual reproduction involves only the contribution of one parent as the fusion of genetic material is not needed. Hence, the offsprings form by cellular division that makes it genetically identical to the parent cell. Energy is not needed to find a mate, the organism simply reproduces on its own by dividing into daughter cells.

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

What complications might arise from genetic screens targeting an organ that differentiates late in development?

Answers

Answer:

No sign of testicular development in boys and breast development in girls.

Explanation:

Complications like no sign of testicular development in boys and breast development in girls occurs if an organ develop very late. There are many causes of this type of complications such as long term illness, eating improper food and disorder of sexual development. Sometime these complications  also occurs due to genetically. These complications should be treated well with medication and use of nutritious food. These medicines increases the performance of sex hormones in order to initiate puberty.

The anticodon (Select all that apply):

a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds

Answers

Answer:

choice A

Explanation:

An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.

Recent research has found that on one island of the Galapagos two finch species interbred. This interbreeding may have resulted in a hybrid species that ultimately led to the extinction of one of the species Darwin discovered. They call this speciation in reverse, or despeciation. Based on what you know about speciation, why are these terms appropriate?

Answers

Answer:

Speciation is defined as an evolutionary process in which one population evolves into a distinct species.

Speciation in reverse, or despeciation is defined as the extinction of an old species due to combining with evolved species to produce hybrid species but it conserves biological lineage.

In the given research, the term used despeciation or speciation in reverse is appropriate as hybrid species resulted from interbreeding of Galapagos two finch species conserved the biological lineage but also loss one of the species Darwin discovered.

Answer:

Speciation is the method by which unique species evolve from a common ancestor. In this case, two of these species that split from a common ancestor interbred and created a hybrid. This hybrid was apparently stronger and possibly better adapted to the environment, which led to extinction of a species formed by the initial speciation event.

Explanation:

Plato

All of the following are functions of the central nervous system except it interprets signals from the external environment it translates signals from the internal organs it receives messages from the peripheral nervous system it sends messages directly to muscles and glands hint: its not A or B

Answers

Explanation:

It sends message directly to muscles and glands

Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.

Answers

Answer:

The two strands of DNA are replicated in different ways

Explanation:

DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).

When the body cells are hypotonic to the blood plasma, water will move from intracellular fluid to extracellular fluid.
A. True
B. False

Answers

Answer:

True

Explanation:

Which phase of mitosis begins when the sister chromatids are cleaved, allowing the two sister chromatids of each pair to separate?

Answers

Answer:

Anaphase

Anaphase

Anaphase

Which process involves a decrease in the dispersal of matter? Select the correct answer below: heat exchange between two solids

Answers

Answer:

The options are

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

The answer is

C.the precipitation of a solid

Dispersal of matter involves the process whereby there is more space occupied by the resulting element/compound than the initial one. For example the conversion of liquid to gas means that it has an increase in the dispersal of matter as the gas particles will contain more space when compared to a liquid.

Precipitation of a solid means conversion of a liquid to a solid. A liquid is known to contain more space which means there is a decrease in the dispersal of matter.

The process that involved the reduction in the dispersal of matter should be the precipitation of a solid

What is the dispersal of matter?

It refers to the process in which it contains the additional space that should be occupied. Like the conversion of the liquid to gas represent there should be increment in the disperson of the matter since the particles of the gas comprise more space at the time when the comparison is to be done with the liquid. Here, precipitation of the solid represent the transformation of the liquid to the solid.

This question is incomplete. Please find the options below.

A.heat exchange between two solids

B.the decomposition of a compound into its constituent elements

C.the precipitation of a solid

D.none of the above

Learn more about dispersal of matter here: https://brainly.com/question/6529880?referrer=searchResults

The Middle Latitudes have:

Answers

Answer:

The Middle Latitudes have cyclones and anticyclones

Explanation:

The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.

The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.

Describe how scent and taste work in conjunction. Are the tastes of below mention foods that were tested heightened by the sense of smell, or only some of the foods?

a. Salt
b. Sugar
c. Lemon Juice
d. Coffe grounds

Answers

Answer:

Scent and Taste work in conjunction because when your brain smells food, it pulls up a picture or memory of that food in your head, and you remember what it tasted like and if you enjoyed it.

Only some of the food. Salt does not really have a smell, so it does not do anything, but all the others do and are heightened

Explanation:

Take cotton candy for example. When you smell cotton candy, you smell SUGAR and lots of it. You know that sugar tastes good and as such you now want to eat the cotton candy.

For this example, we will use lemonade. Lemonade is commonly a drink that most love on a hot summer day at the beach. When you smell the lemonade, it reminds your brain of how good it tasted and pulls up the memory at the back of your mind,  making you feel happy and relaxed. It then ends up tasting better

(This is my first answer, it won't be perfect)

Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

What is Conjuction?

Since salt doesn't truly have a fragrance, it has no effect; nevertheless, all the others do and their intensity is increased.

You can definitely smell a lot of sugar when you smell cotton candy. You want to eat the cotton candy because you are aware that sugar tastes delicious.

On a hot summer day at the beach, most people enjoy drinking lemonade.

Therefore, Smell and taste go hand in hand because when you smell food, your brain conjures up an image or recollection of that food in your head, allowing you to recall how it tasted and if you liked it.

To learn more about conjuction, refer to the link:

https://brainly.com/question/25713213

#SPJ2

Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.


Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change

TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)

Answers

Answer:

During intense exercise:

lung capacity increases

vital capacity increases

respiratory capacity increases

functional residual capacity increases

tidal volume increases

the inspiratory and expiratory reserve volumes decrease as does the residual volume.

Explanation:

Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.

If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.

Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.

It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage

General and Specific knowledge example

Answers

The sky is blue, Planes travel because of the pressure under the wings

GENERAL: the sky is blue SPECIFIC: Planes travel because of the pressure under the wings

ASAP What is a photosynthetic pigment? What is a photosynthetic pigment? A. An oxygen based compound that captures light energy. B. A light sensitive compound that changes color. C. A colored compound that captures light energy. D. A manmade compound that reacts to light.

Answers

I think the answer is A.

Answer:

A. An oxygen based compound that captures light energy.

Which term best describes the difference in colors of the birds below? 4 birds are shown. One has light brown feathers with darker wings. One has very dark feathers with lighter wings. Another has medium brown feathers with light wings. The last one has medium brown feathers with very dark wings. natural selection reproductive maturity genetic variation genetic drift Mark this and return

Answers

Answer:

genetic variation

Explanation:

Genetic variation refers to the difference in genetic content of organisms within a population. The genetic makeup of living organisms are made up of GENES, which exists in contrasting pairs called ALLELES. Each allele is responsible for variation in traits exhibited by the organisms. Differences in the allelic content of organisms of the same species leading to the display of varying phenotypic characteristics is referred to as GENETIC VARIATION.

This is the case in the example given in which four birds in a population possess a range of wing and feather colors i.e light brown feathers with darker wings, dark feathers with lighter wings, medium brown feathers with light wings, and medium brown feathers with very dark wings, all resulting from a variation in their genetic content. Hence, this is an example of GENETIC VARIATION.

Answer:    C. Genetic variation

Explanation: :)

TRBP is a protein important for the formation of the RISC complex. Which of the following would you expect in cells with null mutations in TRBP?
a. Reduced siRNA-mediated mRNA degradation
b. Increased miRNA-mediated translational repression
c. Increased deadenylase-mediated mRNA degradation
d. Reduced proteasome-mediated protein degradation

Answers

Answer:

a. Reduced siRNA-mediated mRNA degradation

Explanation:

The TRBP (transactivation response element RNA-binding protein) is an RNA-binding protein that forms the Dicer complex, which is involved in epigenetic pathways such as those mediated by the RNA interference (RNAi) mechanism. RNAi is a key process where small non-coding RNAs such as, for example, small interfering RNAs (siRNAs) and microRNAs (miRNAs) can inhibit target gene expression at posttranscriptional level by different mechanisms (including the degradation of target mRNAs). A null mutation of this cofactor will alter the Dicer complex, thereby also affecting RNAi pathways mediated by small interfering RNAs.

Other Questions
Question. 1 The product of a monomial and a binomial is a (a) monomial (b) binomial (c) trinomial (d) None of these Why did many oppose the national bank?The bank would not pay for the national debt.The bank could not provide mortgages.A national bank was not mentioned in the Constitution. 1.True or False: How quickly other drugs reach the bloodstream varies depending upon how the drug is put into the system and the type of drug, the age of the user, and the weight of the user.TrueFalse I am confused on this: "Find the area of a square with a perimeter of 20 inches" w is greater than -1 and less than or equal to 4Use a only once in your inequality. Let A= {1 , 2 , 3 , ... ... ...... , 10} and R = {(a, b): a A , b A and a + 2b = 10} Find the domain and range of R. HELP PLEASE PLEASE :( are elephant seals in danger of becoming extinct today? Why or why not? ANSWER DETAILED benefits of democracy Why did the author think e-skin could make better hearing aids? In your answer, explain how the ears connect to the nervous system Sketch the graph of the following equations:y-3x+5y=-3x-5 Why hasnt the woman see a doctor State whether each ratio forms a proportion. 1) 6:3, 18:9 2) 3:4, 30:40 3) 14/18,28/36 4) 2/5,5/2 BRAINLIEST ANSWER GIVEN! Find the equation of the line passing through the pair points (-8,6) (-9,-9). The equation of the line in the form is Ax+By=C. Who was appointed to write the Declaration of Independence? A mother, aged 60, wishes to withdraw monies from her variable annuity to pay for her son's college education. Which statement is true regarding the taxation of the withdrawal? A. The withdrawal is 100% taxable B. Any amount withdrawn above the cost basis is taxable C. Any amount withdrawn above the cost basis is taxable, and is subject to a 10% penalty tax D. The withdrawal is not subject to tax Which of the following elements has a complete outer shell of electrons? A. Iron (Fe) B. Hydrogen (H) C. Neon (Ne) D. Nitrogen (N) Based on the image, which list of 3 points are collinear? Define the six trigonometric functions in terms of x and y Select the correct text in the passage.Which of these excerpts from "Once in a lifetime" by Jhumpa Lahiri most clearly exemplifies diversity within socioeconomic status?