7th grade science questions


How do living creatures produce light?
Describe two ways that bioluminescence is useful to the firefly?
How have coal miners made use of bioluminescence?

Rudolph is famous for his glowing red nose
What could possibly make his nose emit light?
Why would the glow of his nose be red?

Please don't answer just for points, I need this to be done by today! Thank you for your time.​​

Answers

Answer 1

Answer:

Bioluminescence is the production and emission of light by a living organism

Explanation:

Bioluminescence occurs through a chemical reaction that produces light energy within an organism's body. For a reaction to occur, a species must contain luciferin, a molecule that, when it reacts with oxygen, produces light. ... Many organisms also produce the catalyst luciferase, which helps to speed up the reaction.


Related Questions

How does the waste of the pandemic relate to the biosphere?

Answers

Answer:

I think because there aren't a lot of people working, so there is no one to pick up after careless people.

That is the first thing that popped up in my head :\

:D

a cell is placed in a isotonic solution. How does the cell maintain homeostasis in the environment ?

Answers

Answer:

If a cell is placed in an isotonic solution, there will be no net flow of water into or out of the cell, and the cell's volume will remain stable. If the solute concentration outside the cell is the same as inside the cell, and the solutes cannot cross the membrane, then that solution is isotonic to the cell.

Explanation:

hello I need help!!! did I get this right ​

Answers

Answer:

Yeah it is correct.

Explanation:

Things enter the cell through the cell membrane through either active or passive transport which can tell you that the cell membrane controls what goes in and out.

I believe so. I looked it up and it matched everything I found

_____ are simple sugars.

Monosaccharides
Disaccharides
Polysaccharides
Lipids

Answers

Monosaccharides are simple sugars

Answer: monosaccharides

Explanation:

Mt. Pinatubo, a volcano in the Philippines, erupted in 1991. The eruption resulted in the cooling of Earth's surface
for two years.
What can you deduce from the information given?
O Solar energy seeped through the atmosphere,
O The eruption caused sunspot activity to increase.
O The volcano released a lot of sulfur dioxide and ash,
O Greenhouse gases caused the cooling of Earth's surface.

Answers

Answer: this is easy, i think

Explanation:

The volcano released a lot of sulfur dioxide and ash

According to question, "C" which is the volcano released a lot of sulfur dioxide and ash.

What is a volcano and what causes its eruption?

When magma builds up in the magma chamber, it forces its way up to the surface and erupts, often causing volcanic eruptions.

In the ocean, volcanoes erupt along cracks that are opened in the ocean floor by the spreading of two plates called a mid-ocean ridge.

Thus, the volcano released a lot of sulfur dioxide and ash is correct.

To learn more about volcanoes click here:

https://brainly.com/question/12945128

Momentum explains how _____ travels.
A.) sound
B.) heat
C.) both of these
D.) none of these

Answers

Answer:

I think D

Explanation:

I think it’s none. I’m not very confident tho. But momentum wouldn’t rlly relate to sound and heat.

BIOLOGY, I need help on this one

Answers

This is a base deletion

Please I beg someone to help me
Which most likely accounts for the increase in the number of male butterflies in the five years after the initial parasite problem?

Answers

Idk for sure but the first one seems like the best choice :)

Which image shows karst topography?

Ocean with palm trees at the beach.

A sinkhole.

Overhead view of an oxbow and fields.

Answers

Answer:

B

Explanation:

a sinkhole is the answer. I got it on edge 2020

Answer:

its B

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

3. State and explain Chargaff's rules.

Answers

Answer: Chargaff's rules state that DNA from any species of any organism should have a 1:1 stoichiometric ratio (base pair rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.

Explanation:

Please help
Question is in photo

Answers

Answer:

the first one.

Explanation:

Please help me please

Answers

Answer c
Because the lowest one is at the bottom near 5 and the top one is on 25m and for it to be at 11m will be the wrong answer.
THE CORRECT ANSWER IS C IT MAKES SENSE

The destruction of which transport vessel in the plant results in a faster death??​

Answers

Answer:

All of the following are plant adaptations to life on land except ... D) The genes for the synthesis of transport proteins were destroyed. ... A) Xylem tracheids and vessels fulfill their vital function only after their death. ... 51) Ignoring all other factors, what kind of day would result in the fastest delivery of water and minerals to ...

Explanation: MARK BRAINLIEST

There are some similarities between prokaryotic and eukaryotic cells. Which of the following structures is found in both prokaryotic and eukaryotic cells?

Answers

Answer:

Plasma membrane, cytoplasm, ribosomes, and DNA.

Explanation:

There are what eukaryotes and prokaryotes have in common.


30) These two equations are related because the BLANK of cellular respiration are the BLANK of photosynthesis. The BLANK of photosynthesis are the BLANK of cellular respiration.
Plz fill the blanks in :(

Answers

Answer:

Explanation:These reactions occur in the stroma the fluid filled area of a chloroplast ... Photosynthesis Respiration amp Interdependence Two of the 5 basic habitat resources are food and air. ... Without oxygen a cell can extract a net gain of only _____ molecules of ATP from ... Fill in the blanks in the Photosynthesis equation below 15.

34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity

Answers

Answer:

A. Human Development index

Explanation:

The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.

hope i helped

its not gdp nor infant mortality nor carrying capacity

and much more

Answer: the answer is A

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

A hiker has become overwhelmed with heat while walking in the Grand Canyon. The hiker's body goes into overdrive to keep cool in the heat. The hiker needs to hydrate his or her cells. What process is used to regulate homeostasis?

A. Balanced equilibrium
B. Passive transport
C. Cellular transport
D. Hydration

Answers

I think D is the answer

A scientist is studying a radioactive element that has a half-life of 63 years. Choose the correct answers from the drop-down menus to complete each statement about the element.

It will take
blank
years for half of the sample to decay.

In 189 years, blank
of the sample will be left.

Scientists can figure out how old a sample is by multiplying the blank
by the length of the half-life.

Answers

Answer:

It will take 63 years

In 189 years, one-eight of the sample will be left

By multiplying the number of half-life cycles

Explanation:

I just completed this assignment.

A scientist is studying a radioactive element that has a half-life of 63 years. It will take 63 years, In 189 years, one-eight of the sample will be left.

what is the meaning of half life ?

A radioactive element is defined as the material when it changes its atomic number or weight by emitting energy, the energy may be either Alpha, beta, or gamma forms of radiation.

Alpha is a Helium nucleus, a beta particle is an electron and a gamma is high energy electromagnetic radiation. Half-Life can be defined as the time required by which the radioactive substance to split into a different substance.

The half life  was first discovered by Ernest Rutherford and represented by the Ug or t1/2, If the radioactive element has one-hour of half-life, it means  one half of the element would decay within an hour and the remaining part would decay in another hour.

Learn more about half life, here:

brainly.com/question/16387602

#SPJ2

‼️PLEASE HELP THIS IS MY LAST HOPE
List 6 amino acids found in turkey meat. Explain how those amino acids could be formed into a protein including an explanation of translation and transcription.

Answers

Amino acids

1. Tryptophan
2. Threonine
3. Isoleucine
4. Leucine
5. Lysine
6. Methionine
Transcription is a transfer for genetic instructions for DNA to mRNA In the nucleus. But for translation the instructions for mRNA in which is the message, reads and tRNA brings the correct sequence of the amino acids to the ribosome. Then the rRNA helps the bonds form between the amino acids in which its polypeptide which is protein. And makes a polypeptide chain or amino acid chain.
I hope this helps :)

How carbon is uniquely suited to Form biological macromolecules give 3 reasons why

Answers

Answer:

Carbon atoms have four electrons of valance. This enables them to form strong covalent bonds with multiple materials. Carbon can also join with it, allowing it to form long chains or atomic rings on carbon.

hope it helps!

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

Why are animals renewable resources?

Answers

They are renewable natural resources. They move round and round in cycles and never run out. For example a horse eats a plant the horse gets eating by another animal the cycle goes on an on an on

Answer:

They are renewable natural resources. They move round and round in cycles and never run out. When an animal like this cow eats a plant, it takes in nutrients. The nutrients are used in the animal's body and then many come out as waste, which returns the nutrients to the soil.

Before cells divide, they must replicate their entire genome. Explain why
replication of the genome prior to cell division is important.

Answers

Each time a cell divides into two daughter cells, its full genome is duplicated; for humans and other complex organisms, this duplication occurs in the nucleus. This minimizes the incidence of errors (mutations) that may greatly affect the resulting organism or its offspring. ...

HOPE THIS HELPED <3

Answer:

In order for all of the cells in your body to maintain a full genome, each cell must replicate its DNA before it divides so that a full genome can be allotted to each of its offspring cells. If DNA replication did not take place fully, or at all, the offspring cells would be missing some or all of the genome.

Explanation:

scientist have been measuring increasing levels of greenhouse gases in Earth's atmosphere. How do increasing levels affect the atmosphere?

Answers

Well, we have a book to write on this topic but imma explain it briefly plus simply.

Global warming emphasizes the environment with rising temperatures, water shortages, increased fire threats, droughts, weeds and pest attacks, severe storm damage and salt attacks, to name just a few.(In simple words)

Now, we'd go briefly and discuss some common affects briefly :

Hotter days - The climate is getting more and more warmer and year 2015 was the hottest year ever record throughout the history. The Earth's temperature had already warmed by 1°C which is really dangerous. Rising sea levels - Rising sea levels due to climate change is the biggest problem causing natural calamities. Increased ocean temperatures are melting glaciers and ice caps all over the world. Melted ice increases the volume of water in our oceans. Warmer temperatures also result in the expansion of the water's mass, which causes sea levels to rise, threatening islands and coastal cities.More frequent and intense extreme weather - Extreme weather events like bushfires, cyclones, droughts and floods are becoming more common and more aggressive as a result of global warming.

Hope it helps <3

help meeeeeeeeeeeeeeeee plz

Answers

Answer:

It would most likely be within the mantle. the mantle is in the interior of the earth;. So inner core.

Explanation:

HELP ME PLZZ I REALLY NEED HELP WITH THIS AND PLZZ EXPLAIN HOW YOU GOT YOU ANSWER WHEN YOU ARE DONE!!

Answers

Answer:

B.

Explanation:

The organ system is composed of multiple organs that work together to carry out a function.

Need Help Due in 5 min: Earth Science

Answers:

hurricane


snowstorm


tornado


flooding

Answers

Snowstorm is the correct answer

Answer:  a snowstorm would occur

Other Questions
Mary and Carl drove to the store to shop Their trip to the store time at the store and trip home is graphed here. What was theirAverage speed for the entire tripA) 15 km/hB)30 km/hC) 60 km/hD) cannot tell from this data A spa has placed a magazine advertisement in a local womens magazine. What technological feature have the owners incorporated in this advertisement?A. A QR code that is scanned and decodes information directly on the phoneB. Offline integration such as a pop-upC. Interactive contentD. Holoscreen that uses glass media for projectionE. Fog screen that uses fog for image projection Helpppppo pleaseeeeee 1) Which is an objective summary ofthis part of the story?Nisha is nice as well as brave. She*1) lends Neel her PalmCom and takeshim to a subwayNeel records a hologram of an*) elephant Nisha leads Neel to asubway and they become friendly,Neel's hologram makes the tripD) worthwhile. He's lucky Nisha foundhim and took him to the subwayNeel's silly dream came true. Neel is) jealous of Nisha because she workswith elephants Why did Chinese expand their paper and printing activities What are ionic compounds John and Patricia receive a summons to a delinquency case in which their daughter Keira is being charged with vandalism. Which of the following MUST have happened before John and Patricia received their summons? A. Keira was placed on probation B. a judges disposition C. the filing of a petition of complaint D. Keira was given a formal indictment by a grand jury Please select the best answer from the choices provided A B C D Which statement identifies a mistake Anna made if any Select the correct answer from each drop-down menu.Plan called for a unicameral legislature.Plan suggested a bicamerallegislature with population determining the number of members per state in both houses of government. In the end,the delegates adoptedPlan. Then they revised it further. Please help pass my final :( You mix soil and water in a jar. After a few days, the soil has settled to thebottom of the jar and the water is at the top. What classification of matter isthis??A compoundsB elementsC. mixturesD. pure substance What kinds of paintings were most popular among important people of the time? TELL ME WHYWhich graph shows a proportional relationship between the number of hours of renting a bike and the total amount spent to rent the bike? (5 points) Some historians believe the caste system developed as a result of new rules and laws brought on by the invasion of WHICH nomadic society? A: aryans B: hittiesC: dravidians D: brahmans 6th grade history i mark as brainliest is 3399 a rational number PLEASE HELP DUE TODAY. Hay un muchacho que se llama Hector. Hector es un muchacho atletico pero no es muy inteligente. Un dia,Hector camina a Roosevelt High School. El camina a clase de Matematicas, y en frente de la clase deMatematicas, Hector ve a Maria. Maria es una muchacha muy atractiva y responsable. Hector esta nerviosoporque Maria le gusta.Hector le dice a Maria: Hola Maria! como estas?Maria responde: estoy muy nerviosa! estoy muy nerviosa porque no hay profesor en clase!Hector dice: que??Hector ve que no hay profesor en la clase de Matematicas, hay un monstruo...y dice...<corre!>> Y Hector corre en la otra direccion.Maria dice: este muchacho no es muy inteligente, el ve un monstruo pero solo es una figurina de ceramica!FinTranslate in English plsss! Which of the following statements is TRUE?A. You only need to be flexible if you are a dancer.B. Being flexible can help prevent chronic illnesses like back pain.C. Individuals older than 60 years old should not work on their flexibility.D. There are no benefits of flexibility training for boys. A family has four daughters, Molly, Daisy, Rosie and Tilly. Daisy is six years older than Molly. Molly is four years younger than Tilly. Rosie is one year older than double Molly's age. The total of their ages is 51.Find the age of each of the four girls.