4. What is evolution? Explain how artificial selection causes populations to change.

Answers

Answer 1

Answer:Artificial selection is the process by which humans choose individual organisms with certain phenotypic trait values for breeding. If there is additive genetic variance for the selected trait, it will respond to the selection, that is, the trait will evolve. evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection. Evolution can an animal to make it almost unrecognisable, like cephalopods and how they evolved to make them more buoyant


Related Questions

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411

Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?

mouth-- stomach-- small intestine-- large intestine-- rectum

rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth

mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum

mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum

Answers

This is hard ........!!!!!!

Answer:

mouth--esophagus--stomach--small intestine---large intestine---rectum

Explanation:

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

What is the role of DNA in an organism ? how is dna related to reproduction​

Answers

Answer:

DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce. 

Place the appropriate terms into the table

Answers

Answer:

Kindly, provide us with a table, thank you! :)

Explanation:

Can we see the table lol? :)

DNA is a molecule that stores____information in the cells

Answers

Answer: instructions

Explanation: trust me

Answer:

genetic

Explanation:

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.

Answers

Answer: D

Explanation:

Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.

Which sex cell is produced in males?

Answers

Answer:

Sperm

Explanation:

Answer:

Sperm

Explanation:

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

What percentage of Japan’s population is between the ages of 0–4 years?

Answers

Answer:

looks like about 8% to me

40 to 44 percent of people are in the range of 0 to 4 years.

What is the population?

A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.

In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.

In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.

Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.

To learn more about the population, refer to the link:

https://brainly.com/question/27991860

#SPJ2

What are the differences between parents and offsprings ?

Answers

Answer:

Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.

Answer:

Parents have offspring

Explanation:

Offspring is the result of sexual or asexual reproduction by parents.

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!

which two technologies use reflected sound waves

Answers

Answer:

one of them is SONAR

Explanation:

Other one is megaphone

Answer: There are 3 of them that are: radar, sonar and lidar.

Explanation: I used google to answer this

The water cycle gets its energy from the ___?

Answers

Answer:

the sun

Explanation:

WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?

4x + y = 4
2x + 7y = 28

4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28

Answers

Answer:

D.

Explanation:

Answer:

D

Explanation:

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

In guinea pigs, the allele for black fur(B) is dominant over the allele for
brown fur(b), and the allele for short fur (F) is dominant over the allele
for long fur(1). What percent of the offspring of a BbFf x bbff cross will
be heterozygous for both traits?
Select one:

100%
25%
0%
50%

Answers

Answer: 50%

Explanation:

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?

A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.

B It hasn't rained enough and the plants aren't getting enough water.

C The factory has increased the temperature in the area.

D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.

Answers

Answer:

D

Explanation:

If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants

explain how gas is compressed into liquid in a gas barrel

Answers

Explanation:

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. ... In liquids, the molecules are very near than that of gases.

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

Germination will not happen unless a seed

A. is dispersed far from the plant that produced it.
B. absorbs water.
C. uses its stored food.
D. grows stamens and a pistil.

Answers

I think it’s B. Absorbs Water

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ​

Answers

Answer:

A

Explanation:

Egg cell

The level of structural organization which best describes an egg is: A. a cell.

A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.

The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.

An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.

In conclusion, the level of structural organization in animals cells can best be describe by using an egg.

Read more: https://brainly.com/question/19559847

Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.

Answers

Answer:

I think it is glucose.i hope this helps!

Explanation:

Answer:

the correct answers are glocose, respiration, and oxygen

Explanation:

i got it right

Other Questions
This is the last one!!! 7)Which expression is a SUM?5(2 + 3)8 x (6 + 3)5(2) + 2(6 - 3)(5 + 2) = (2 + 3) 1. On a quiet day without many witnesses, a 4.5 ft victim is shot by a sniper thatwas in a tower 780 ft away. If the angle of elevation is 48 from the victim, atwhat vertical distance did the sniper shoot from? What sentence uses specific language? Each group in the class has a choice of several projects to complete. Mr. McCole is available to answer certain questions we have about the project. We have to organize ourselves into eight groups of four students each. You will have several minutes to complete each task assigned to you. During the election for a new city mayor, Sheila held several news conferences to explain in detail how she would address the important issues that the city was facing. Another candidate, Novia, bought TV advertisements that showed local celebrities supporting her for mayor. According to the elaboration likelihood model, Sheila was attempting to use persuasion by the ________ route and Novia was using persuasion by the ________ route. Group of answer choices secondary; primary peripheral; central central; peripheral primary; secondary Please cant Gail this A sample of water is heated from 10.0 degrees Celcius to 15.0 degrees Celcius by the addition of 125 Joules of heat. What is the mass of the water? A sample of carbon dioxide occupies a volume of 1.50L at 165KP pressure. What pressure would the gas exert if the volume was increased to2.5L?a.0.023 kPab. 275 kPac. 99 Ld. 99 kPa Gaseous butane will react with gaseous oxygen to produce gaseous carbon dioxide and gaseous water . Suppose 42. g of butane is mixed with 150. g of oxygen. Calculate the maximum mass of carbon dioxide that could be produced by the chemical reaction. Round your answer to significant digits. Barton and Fallows form a partnership by combining the assets of their separate businesses. Barton contributes accounts receivable with a face amount of $48,000 and equipment with a cost of $186,000 and accumulated depreciation of $105,000. The partners agree that the equipment is to be valued at $90,000, that $3,700 of the accounts receivable are completely worthless and are not to be accepted by the partnership, and that $1,900 is a reasonable allowance for the uncollectibility of the remaining accounts receivable. Fallows contributes cash of $28,300 and merchandise inventory of $56,000. The partners agree that the merchandise inventory is to be valued at $60,500. Journalize the entries to record in the partnership accounts (a) Barton's investment and (b) Fallows's investment. If an amount box does not require an entry, leave it blank. (a) (b) How did the fact that people began living longer in the colonies affectattitudes toward labor?O. A. It increased the value of owning slaves over hiring indenturedservants.B. It led to laws controlling the number of workers.C. It led to laws protecting the health of slaves and indenturedservants.O D. It increased a feeling of kinship among classes. Amy has 2 crayons. Cameron gives her 5 more crayons. How many crayons does Amy have now? Will give brainliest answer Need help please owo with all of them help ASAP , BRAINLIEST will be given if correct. Why do the cells inside of your stomach get replaced every few days , but other cells in your body can live for weeks, months or even years? Question 5What Asian country did Nixon seek to build a relationship with?JapanChinaTaiwanNo answer text provided. Which central idea expresses a viewpoint?There are three neighborhood pools, two playgrounds, and one library in our community.A teen center would be a great addition to the community center, providing teens with a place to go.Teenagers are discouraged from loitering in public places, such as store fronts and parking lots.Skateboarding is prohibited at the playgrounds as a safety precaution for young children. An idea thats intended to make the reader take notice and want to read on is called a Do elementary school students obtain a fair amount of homework?