4. How many molecules are equal to 2.25 moles of sulfur dioxide?


5. How many moles are equal to 2.4 x 1023 particles of sodium chloride?

Answers

Answer 1

Answer: 4. We know that one mole of any chemical compound always contains 6.022 x 10^23 molecules. Therefore, we can calculate the number of molecules of 2.25 moles of sulfur dioxide SO2 by multiplying the number of moles by the Avogadro's constant 6.022 x 10^23:    

    2.25 moles SO2 (6.022x10^23 molecules/1mole) = 1.355 x 10^24 molecules of sulfur dioxide

5. The number of moles of sodium chloride are 0.40 moles

Explanation:


Related Questions

A cough sytup contains 0.5M dextromethophan. How many moles of the cough supressant are in 21.3mL of the cough syrup?

Answers

Answer:

0.0107 mol

Explanation:

Multiply concentration by volume (in liters) to get moles.

0.5 M • 0.0213 L = 0.0107 mol

The weight of the elephant is 4500 kg, and the area of ​​the sole of one of its legs is 1700 cm2. Calculate the pressure of the elephant on the ground.

Answers

Answer:

64852.94 N/m²

Explanation:

From the question,

P = F/A.................... Equation 1

Where P = Pressure of the Elephant on the ground, F = Weight of the Elephant, A = Area of the sole of the four legs.

But,

F = mg.............. Equation 2

Where m = mass of the elephant, g = acceleration due to gravity

Substitute equation 2 into equation 1

P = mg/A............ Equation 3

Given: m = 4500 kg, A = (1700×4) cm² ( The elephant has four legs) = 6800 cm² = 0.68 m²

Constant; g = 9.8 m/s²

Substitute these values into equation 3

P = (4500×9.8)/0.68

P = 64852.94 N/m²

What is the heat capacity of a substance in which 1050 grams will rise in temperature from 30.4°C to 25.7°C when it absorbs 2880 joules of heat?

Answers

Answer:

0.584 J/g°C

Explanation:

Using the formula as follows;

Q = m × c × ∆T

Where;

Q = amount of heat (joules)

m = mass of substance (g)

c = specific heat capacity (J/g°C)

∆T = change in temperature (°C)

According to the information in this question;

mass of substance (m) = 1050g

Initial temperature = 25.7°C

Final temperature = 30.4°C

amount of heat (Q) = 2880J

change in temperature (∆T) = (30.4°C - 25.7°C) = 4.7°C

Using Q = m.c.∆T

c = Q ÷ m∆T

c = 2880 ÷ (1050 × 4.7)

c = 2880 ÷ 4935

c = 0.584 J/g°C

The specific capacity of the substance is 0.584 J/g°C.

Jessica jogs on a path that is 25 km long to get to a park that is south of the jogging path if it takes us a good 2.5 hours then what is her speed?

Answers

She jogs 10km per hour. Hope this helps :)

I need help with science: Which picture best shows a loud, low-pitched sound?​

Answers

Image A shows a loud and low-pitched sound.

What is the frequency?

The term frequency refers to the number of waves that pass a fixed point in unit time.

High pitched sound is of higher frequency because they make the air molecules vibrate much faster than low-pitched sound. Due to their high frequency, their wavelength is shorter (Remember wavelength and frequency are inversely proportional). Vice versa is true to the low-pitched sound. They vibrate air molecules slower than high-pitched sound. Their wavelength is longer and frequency smaller.

Hence, option A is the correct answer.

Learn more about frequency here:

https://brainly.com/question/3280221

#SPJ2

How many moles of C6H12O6 does 8.2 x 1023 molecules represent

Answers

Answer:

i.e. mass of 1 mole of glucose, C6H12O6 = (6 × 12.01 + 12 × 1.01 + 6 × 16.00) g = 180.18 g (using atomic weight data to 2 decimals) 1 mole of carbon atoms weighs 12.01 g and there are 6 moles of C atoms in 1 mole of glucose, so the mass of carbon in 1 mole of glucose = 6 × 12.01 g = 72.06 g.

Which of the following are also compounds? Select all that apply.


A.
CuFeS2


B.
H2O


C.
KCl


D.
Mg


E.
Cl

Answers

Answer:

option B,C and A are compound

A student prepares four different aqueous NaCl solutions according to the table. Which solution will have the highest molarity?

Answers

Answer:

what did you end up guessing

Explanation:

please help me :)

( check the photo! )

Answers

Answer:

plastic rays i think the matetial that can widely recycle

Plastic trays and biscuits wrappers

PLZ HELP! QUESTION IS BELOW! :D

Answers

Personal connection is a connection with your own self to something

Answer:

Explanation:

When we say anything is a wave, what exactly do we mean? The most intuitive and straightforward wave to envision is a water wave. A motion, more specifically, is a disturbance that propagates or travels away from its source. Water waves are caused by a disruption in the water's surface, such as a rock tossed into a pond or a swimmer splashing the surface continuously. The noise for sound waves is a rise of air pressure, which may be caused by the oscillating cone within a speaker. There are many kinds of disturbances in earthquakes, including surface disturbances and pressure disturbances under the surface. Even radio signals are best deciphered by using a comparison of sea waves Water waves are helpful to visualize since they are more than just a mental picture. The amplitude, period, frequency, and energy of water waves are all the same as they are for all waves. A small set of underlying principles can be used to describe all wave characteristics.

(hope this helps can i plz have brainlist :D hehe)

Would this be a strong or weak acid

Answers

Answer:

It Should  be Strong Acid

Explanation:

Strong acids and bases ionize fully in an aqueous solution. Weak acids and bases also ionize, but only partially and the reaction is reversible. So how do we know if an acid or base is strong or weak? A simple way to determine strength is to add the acid or base to water— high reactivity means a stronger acid or base. This reactivity is measured with a value called the Ka or Kb value. It tells us how reactive an acid or a base is based on how many hydronium or hydroxide ions are formed during the reaction. Hope it helps :)

The specific heat of nickel is 0.445 J/g degree Celsius. How much heat is required to heat a 168 gram piece of nickel from 15.2 degrees Celsius to 43.6 degrees Celsius?

Answers

.445 • (43.6 - 15.2) • 168 = 2123.184

ANSWER - 2123.184 J

Type the correct answer in each box.

Balance the equation.

_____SiO2 + ______CaC2 → _____Si + _______CaO + _____CO2

Answers

The balanced equation of the given reaction is as follows: 5SiO2 + 2CaC2 → 5Si + 2CaO + 4CO2.

How is an equation balanced?

A chemical equation is said to be balanced when the number of atoms of each element on both sides of the equation is the same.

According to this question, a chemical reaction between quartz and calcium chloride is given to produce silicon, calcium oxide and carbon dioxide.

The balanced equation that represents an equal number of atoms on both sides is as follows:

5SiO2 + 2CaC2 → 5Si + 2CaO + 4CO2

Learn more about balanced equation at: https://brainly.com/question/7181548

#SPJ1

A covalent bond is formed when two atoms reach a stable state that balances:

MARK TWO RESPONSES

A
the repulsion between the nucleus protons of one atom to the electrons of the other atom


B
the attraction between the nucleus of one atom to the electrons of the other atom


C
the attraction between the two nuclei of the atoms, which both contain protons


D
the repulsion between the two nuclei of the atoms, which both contain protons

Answers

Answer:

B and I think A but you may want a secon opinion on that

Explanation:

I know that electrons are shared with covalent bonds so I assume the 2 answers are the ones with electrons it them

B and A

Explanation : ^

If 5.7 mol Cl2 reacts with Na , how many grams of NaCl could be formed? The
molar mass of NaCl is 58.44 g/mol

Answers

Answer:

666.22grams

Explanation:

The balanced chemical equation of this reaction is given as follows:

2Na + Cl2 → 2NaCl

Based on the above equation, 1 mole of Chlorine gas (Cl2) is needed to produce 2 moles of sodium chloride (NaCl).

Therefore, 5.7moles of Cl2 will react to produce (5.7 × 2) = 11.4moles of NaCl.

Note that, the mass of NaCl was asked in this question. We find the mass of NaCl from the mole by using the formula;

moles = mass/molar mass

Molar mass of NaCl = 58.44 g/mol

11.4 = mass/58.44

mass = 58.44 × 11.4

mass = 666.22grams.

How many kilojoules are needed to convert 77.5 grams of ice at -8.00°C to water at 95.0°C?


Ahh, Thank you!!! ( ;-;)​

Answers

q=mcθ
m= 0.0775 kg
c= 4184 J·kg−1·K−1.
θ= T(final) - T(initial), 95-(-8)

Q=33398.78 J so kJ divide 1000

= 33.39878 kJ

How many oxygen molecules are in a flask that contains 1.43 grams of oxygen?

Answers

Answer:

0.08937835168818843

Explanation:

1 grams Oxygen is equal to 0.062502343837894 mole.

Which type of ion usually undergoes reduction?

No ion

All ions

Anion

Cation

Answers

Answer:

anion

Explanation:

anion undergoes reduction.

cation undergoes oxidation.

The ions are categorized according to the process of oxidation and reduction. The ion usually undergoes reduction is an anion.

What is reduction?

A process involving the partial or complete gain of electrons and loss of oxygen. The ions acquire a net negative charge on them.

Thus, anions usually undergo a reduction.

Learn more about Reduction.

https://brainly.com/question/14698511

#SPJ2

Fluorine, chlorine, and bromine react with gold.
which 1 of the 3 elements will be the most reactive with gold

thanks

Answers

Answer:

gold i believe or possibly bromine

Explanation:

q- how does fluorine react with gold

a- this fluoride compound features gold in its highest known oxidation state. this red solid dissolves in hydrogen fluoride, but these solutions decompose, liberating fluorine.

q- how does chlorine react with gold

a- gold does react with halogens. it'll, for example, react very slowly with chlorine gas at room temperature to form gold chloride, AuCl3. if gold chloride is heated gently, it will decompose to release the pure elements again.

q- how does bromine react with gold

a- gold in bromine solutions dissolves according to electrochemical/chemical (EC) mechanisms. ... in the chemical composition of the mechanism, this monovalent gold bromide disproportionate into gold and stable AuBr −4 , which reports into solution. with respect to pH, there are two characteristic dissolution regions.

** sorry that i can't provide a sure answer**

good luck :)

i hope this helps

have a nice day!

Fluorine will be most reactive with gold.

What is fluorine?

Of almost all of the elements, fluorine seems to be the most electronegative as well as reactive. Fluorine would be a diatomic, pale yellow, extremely corrosive, combustible gas with a strong smell. The lightest halogen would that be. It produces oxygen and even the incredibly corrosive hydrofluoric acid when it combines strongly with water.

What is reactive?

Reactivity would be a substance's capacity to chemically combine with several other substances. Iron, for instance, reacts vigorously with oxygen.

As you move down the group, the halogens, which are non-metal elements in Group 7, become less reactive. In contrast to the alkali metals within Group 1 of the particular periodic table, this trend is the opposite. One of the most reactive elements in Group 7 was fluorine.

To know more about fluorine.

https://brainly.com/question/1940697

#SPJ3

An unknown amount of sodium azide (NaN3) reacts and produces 0.033 moles of nitrogen gas. What mass of sodium metal is produced

Answers

Answer:

Mass of sodium metal is 130.87 gram

Explanation:

The complete reaction is

2 NaN3 --> 2 Na + 3 N2

We know that PV = nRT

n = [tex]\frac{PV}{RT}[/tex]

On substituting the given values, we get

[tex]n = \frac{\frac{99707}{101325}*75 }{0.082 *(273.15 +15)} \\n = 3.02[/tex]moles of N2

Sodium azide's molar mass

3.02 *(2/3) = 2.013 moles

Mass = 2.03 * 65.01 = 130.87 gram

An eraser is an example of —

Group of answer choices

an insulator

a closed circuit

a conductor

an open circuit

Answers

Answer:

Insulator

Explanation:

An eraser can't conduct electricity, which makes it an insulator.

definition of compounds​

Answers

a thing that is composed of two or more separate elements; a mixture.

Please help me out this is a test.


The imaje shows a plate baundary. Arrows have been added to indicate the movement if the plates.

Answers

The correct answer should be H. I hope this helps!

Coniferous forests grow in a wide range of climates, from the coldest polar regions to the warmest tropical regions and everything in between. Circle True or False. ​

Answers

The answer is true, yw.

Coniferous forests grow in a wide range of climates, from the coldest polar regions to the warmest tropical regions and everything in between. This statement is true.

What are conifers ?

Conifers are  a type of gymnosperm plants bearing cone like structures in which the seeds are located. Don't be fooled by the fact that coniferous woods are widespread around the world. Some of the wildest trees in the world can be found there.

Hyperion, a coastal redwood tree, is the tallest tree in the world, reaching a height of 379 feet, equivalent to a 35-story structure. From Siberia to Canada, coniferous rainforest biomes can be found. They have cold winters and warm to hot summers.

Temperatures in coniferous forests are quite low all year long. Summertime temperatures range from -7°C to 21°C, while the average wintertime temperature ranges from -54°C to -1°C. Hence, the statement is true.

Find more on conifers:

https://brainly.com/question/30415885

#SPJ6

What is the name
of the reigning
theory about the
origins of the
universe?

Answers

Answer:

please follow me

Explanation:

eyye6ww6yeyosuyoyo6owy

Big Bang theory is the most common one ive heard of

The volume of a gas is 550 mL at 960 mm Hg and 200.0 C. What volume

would the pressure of the gas be 830 mm Hg if the temperature is reduced

to 150.0C? Make sure your answer is rounded to nearest whole number

and your final answer has the units of mL. *

Answers

Answer:

The volume will be 568.89 mL.

Explanation:

Boyle's law says that "The volume occupied by a given gaseous mass at constant temperature is inversely proportional to pressure"

Boyle's law is expressed mathematically as:

Pressure * Volume = constant

or P * V = k

Gay-Lussac's law indicates that when there is a constant volume, as the temperature increases, the pressure of the gas increases. And when the temperature is decreased, the pressure of the gas decreases. That is, the pressure of the gas is directly proportional to its temperature. Gay-Lussac's law can be expressed mathematically as follows:

[tex]\frac{P}{T}=k[/tex]

Where P = pressure, T = temperature, K = Constant

Finally, Charles's law indicates that as the temperature increases, the volume of the gas increases and as the temperature decreases, the volume of the gas decreases. In summary, Charles's law is a law that says that when the amount of gas and pressure are kept constant, the quotient that exists between the volume and the temperature will always have the same value:

[tex]\frac{V}{T}=k[/tex]

Combined law equation is the combination of three gas laws called Boyle's, Charlie's and Gay-Lusac's law:

[tex]\frac{P*V}{T} =k[/tex]

Studying an initial state 1 and a final state 2, it is fulfilled:

[tex]\frac{P1*V1}{T1} =\frac{P2*V2}{T2}[/tex]

In this case:

P1= 960 mmHgV1= 550 mLT1= 200 C= 473 K (being 0 C=273 K)P2= 830 mmHgV2= ?T2= 150 C= 423 K

Replacing:

[tex]\frac{960 mmHg*550 mL}{473K} =\frac{830 mmHg*V2}{423 K}[/tex]

Solving:

[tex]V2=\frac{423 K}{830 mmHg} *\frac{960 mmHg*550 mL}{473K}[/tex]

V2= 568.9 mL

The volume will be 568.89 mL.

can i get a snap i could send a link to, to do a few chem 1 assignments i could award more points

Answers

Answer:The FitnessGram PACER Test is a multistage aerobic capacity test that progressively gets more difficult as it continues. The test is used to measure a student's aerobic capacity as part of the FitnessGram assessment. Students run back and forth as many times as they can, each lap signaled by a beep sound.

Explanation:

can somebody explain two dimensional gas chromatography in arson investigation

Answers

Answer:

Comprehensive Two-dimensional gas chromatography, or GCxGC is a multidimensional gas

An unknown amount of Al203 decomposed producing 215 g of solid aluminum. 2Al2O3=4Al+3O2 How many grams of oxygen gas should be produced

Answers

Answer:

191.11 grams of oxygen gas should be produced.

Explanation:

The balanced reaction is:

2 Al₂O₃ → 4 Al + 3 O₂

By stoichiometry of the reaction (that is, the relationship between the amount of reagents and products in a chemical reaction), the following amounts of moles of each compound participate in the reaction:

Al₂O₃: 2 molesAl: 4 molesO₂: 3 moles

Being the molar mass of each compound:

Al₂O₃: 102 g/moleAl: 27 g/moleO₂: 32 g/mole

By reaction stoichiometry, the following mass quantities of each compound participate in the reaction:

Al₂O₃: 2 moles* 102 g/mole= 204 gramsAl: 4 moles* 27 g/mole= 108 gramsO₂: 3 moles* 32 g/mole= 96 grams

Then you can apply the following rule of three: if by stoichiometry 108 grams of aluminum are produced along with 96 grams of oxygen, 215 grams of aluminum are produced along with how much mass of oxygen?

[tex]mass of oxygen=\frac{215 grams of aluminum*96 grams of oxygen}{108grams of aluminum}[/tex]

mass of oxygen= 191.11 grams

191.11 grams of oxygen gas should be produced.

PLZ HELP!

Where have you seen or known of examples of waves in YOUR LIFE? Based on science terms of a wave.

Answers

Answer:

QUESTION:

Where have you seen or known of examples of waves in YOUR LIFE? Based on science terms of a wave.

ANSWER:

I've seen the following in my life:

~ Lightwaves

~ Heatwaves

~ Electromagnetic waves

~ X-rays

~ Tsunami Waves

Explanation:

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.  

Other Questions
Help me please !!!!!! 1. When there is light, photosynthesis canA. occur, in the chloroplast.B. not occur, and the stomata will not be open.C. not occur, and the stomata will be open.D. occur, in the mitochondria. Anyone know how to do this? PLEASE HELP AND NO FILES PLEASE1. you spin a penny and a nickel on a table. The penny lands on heads and the nickel lands on tails. find the probability2. A container has 7 green buttons, 3 yellow buttons, and 4 blue buttons. You reach in and randomly draw out a blue button. You KEEP the blue button and reach in again to draw out a second blue button. find the probability. You decide to study the effects of smoking, drinking and partying on life satisfaction. To do so, you assign people randomly to one of two smoking conditions (smoking or not), one of three drinking conditions (no alcohol, 1 drink per day, several drinks per day) and partying conditions (no partying, 1 hour of partying per day, 2 hours of partying per day). This design has An obstacle to sustainable development is the growth of ecotourism increasing reliance on fossil fuels negative population growth in developed countries farm to table restaurants decrease mass consumption If angle 3 is 4x+1 and angle 4 is 7X+3. what are the measures of angle 3 and 4? Which of the following is NOT a benefit of fitness walking?O Improves your visionO Strengthens your hearto Improves self-image and releases stressO Can be done anywhere, in any weather When identifying properties of n - sided polygons where 3 _< n Choose the correct simplification of the expression a^9 multiplied by b^10/a^2 multiplied by b^7A^11b^171/a^11b^171/a^7b^3A^7b^3 Suppose you invest money in two accounts. One of the accounts pays 4% interest annually, andthe other account pays 5% interest annually. You have $ 2000 more invested in the account paying4% than in the account paying 5%. How much do you have invested in the account paying 4% ifyou earn $ 670 interest in a year? Fill two Zip Loc bags half full of water. Put food coloring in both bags. Zip both bags. Tape one bag to a sunny window. Tape the other bag to a shady window. After 30 minutes, observe the bags to see which one changed the most. The purpose of the directions above is to OA. describe the results of a safe science experiment OB. entertain the reader with a game of plastic bags. OC. describe the process for a science experiment. OD. persuade the reader to use a certain kind of bag. What belief system was endorsed by the state that ruled the holy land in 550 CE 3. What organ(s) did Jason donate to Ronald Griffin? sub (7x+5)(2x28x+6). The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates.