3. How would you describe the waxing versus the waning portion of the moon’s journey

Answers

Answer 1

Answer:

A lunar eclipse would occur when the Earth is between the sun and moon. ... 3How would you describe the waxing versus the waning portion of the moon's journey? The waxing is when the moon is “growing”, while the waning is when the moon is “shrinking”.


Related Questions

g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Answers

Answer:

The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.

Explanation:

Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.

A mutation causes a sequence of DNA that has the nucleotides TTG to be changed to TCG. The resulting protein has a different sequence of amino acids. Which type of mutation is this? a. missense b. nonsense c. silent d. frameshift

Answers

Answer:

The correct answer would be - a) missense.

Explanation:

A missense mutation is a type of a point mutation that is caused by the alteration or change in the a nucleotide of a triplet codon in a DNA sequence. This leads to a altered mRNA and incorporate different amino acid and ultimately different protein than usual.

This type of mutation can produce non functional protein by translation in most of the case and did not make any big change in the individual.

Thus, the correct answer would be - a) missense.

Answer:

A. Missense

Explanation:

edge 2020 100%

cytoplasm and nucleus together constitute which part​

Answers

Answer:

Cytoplasm and nucleus together constitute Protoplasm .

protoplasm is your answer mate

True or dalse. The cell that produces interferon is protected from the infectious agent.​

Answers

Answer:

True

I hope this helps!

What is the relationship between DNA mutation and sickle-cell anemia? (1 point)
O Sickle-cell anemia and DNA mutations are correlated without any causal relationship.
O Sickle-cell anemia causes a DNA mutation.
O A DNA mutation causes sickle-cell anemia.
O A DNA mutation is correlated with but does not cause sickle-cell anemia.

Answers

Answer:

A DNA mutation causes sickle-cell anemia.

Explanation:

Sickle cell anemia is caused by a single code letter change in the DNA. This in turn alters one of the amino acids in the hemoglobin protein. Valine sits in the position where glutamic acid should be. The valine makes the hemoglobin molecules stick together, forming long fibers that distort the shape of the red blood cells, and this brings on an attack.

Which of the following not an enzyme
mediated process
1) G1
and G2
phases of meiosis
2) S-phase of mitosis
3) Pachytene of meiosis-I
4) None of the above

Answers

Answer:

4) None of the above

Explanation:

Enzymes are known for mediating biological or chemical processes.

Meiosis and mitosis both are part of a biological process called cell cycle or cell division.

The cell cycle is mediated by enzyme cyclins and cyclin-dependent kinases (CDK). cyclin-CDK in G1 phase helps to prepare the cell for S phase. cyclin-CDK also drives Pachytene of meiosis-I

During S-phase of mitosis, ubiquitin ligase helps in mitotic spindle assembly.

Hence, the correct answer is "4) None of the above"

The process of ________ involves a carrier protein that can transport a molecule across the cell membrane down its concentration gradient.

Answers

Answer:

Answer is Facilitated diffusion.

The process of facilitated diffusion involves a carrier protein that can transport a molecule across the cell membrane down its concentration gradient.

What is facilitated diffusion?

The process of spontaneous passive movement of molecules or ions across a biological membrane by particular transmembrane integral proteins is known as facilitated diffusion.

To transfer molecules from one side of the membrane to the other without consuming energy, facilitated diffusion is required. Large and charged molecules require facilitated diffusion more than smaller molecules. These compounds are unable to readily diffuse through the plasma membrane.

It happens when chemicals like glucose or amino acids flow effortlessly from a high concentration to a low concentration.

Learn more about facilitated diffusion, here:

https://brainly.com/question/15162488

#SPJ6

In most organisms, the end product of glycolysis is pyruvate. Pyruvate still contains a substantial amount of energy, which can be further extracted. Whether the organisms are operating under aerobic or anaerobic conditions determines the metabolic pathway that pyruvate undergoes to produce more ATP. In this tutorial, you will identify the end products of these metabolic pathways.

Answers

Answer:

Pyruvate helps in the production of ATP.

Explanation:

The molecule of pyruvate converted into acetyl CoA. Then each molecule which is produced during glycolysis loses electron and carbondioxide releases. After the breakdown of pyruvate, the electrons loses by pyruvate are transferred to NAD+ in order to produce NADH, which will be used by the cell to produce energy molecule such as ATP. So we can say that pyruvate plays a vital role in the formation of ATP molecule.

What are some pros and cons of using a dispersant versus bacteria to deal with a very large spill and how would each one impact the environment

Answers

Answer:

it is toxic to the health

Explanation:

Dispersants create a toxic environment for fish by releasing harmful oil break-down products into the water. ... Dispersants and dispersed oil have also been shown to have toxic effects on bird eggs that are similar or worse than from untreated oil.

Which process in the carbon cycle is
performed by BOTH plants and animals?
Cellular Respiration
Decomposition
Photosynthesis
Burning (combustion)

Answers

Question :

Which process in the carbon cycle is

Which process in the carbon cycle isperformed by BOTH plants and animals?

Answer:

Cellular Respiration

Decomposition

Photosynthesis

Burning (combustion)

What substance heats up the fastest: water, dry sand, wet sand, rock

Answers

Answer:

The specific heat capacity represents the amount of energy, in joules, that it takes to raise the temperature of one gram of a given substance by one degree Celsius. Put more simply, the amount of energy it takes to raise a quantity of water by one degree Celsius would raise an equivalent quantity of sand by a little over 14 degrees. Likewise, sand does not need to lose nearly as much energy as water to produce equivalent cooling. Since it "holds" a lot less energy, it cools down much faster than sand.

Indeed, liquid water has an unusually high specific heat capacity. Because it is much less prone to temperature swings than other common substances, large bodies of water often work to moderate temperatures in a region. This helps to explain, for example, why average temperatures fluctuate very little over the year in San Francisco, a cit

E

____ are thought to be present before vertabrates

Answers

Answer:

Jawless fish was present before vertebrates.

Explanation:

Jawless fish has some characteristics of vertebrates and also considered as the ancestor of vertebrates on earth which is similar in appearance with the hagfish. It was present about 500 to 600 million years ago. They consist of cranium but vertebral column is absent. but with the passage of time, evolution occurs and many animals which was the descendant of this jawless fish having vertebral column or backbone in their body.

b) How will you describe any three (3) major components of the environment to a named
class puyil?​

Answers

Answer:

Hydrosphere, atmosphere and biosphere are the three major components of the environment.

Explanation:

Hydrosphere, atmosphere and biosphere are the three major components of the environment. hydrosphere refers to water bodies such as ocean, sea, ponds and lakes etc that is present in our environment. atmosphere refers to the gaseous layer which is present above the earth surface. in this layer oxygen, nitrogen and carbondioxide etc are present. biosphere refers to all living organisms such as human, animals, plants and microbes etc which are present on earth surface..

The idea that chromosomes orient themeselves randomly during metaphase I is ________________________. This leads to ___________________ combinations of genes.

Answers

Answer:

The idea that chromosomes orient themselves randomly during metaphase I is Independent Assortment. This leads to more combinations of genes.

Explanation:

During metaphase I, the pair of chromosomes align in the plate of the cell. In this step, the independent assortment takes place.

The independent assortment is the distribution of different genes into two gametes, is independent, because the distribution of the different genes, does not influence the distribution of the other genes. The independent assortment leads to new combinations of genes from the parental and maternal side, resulting in offsprings that do not look exactly like their parents.

g dGDP is made from ________ by the ribonucleotide reductase. This enzyme is inactive when ______ is bound to its master regulatory pocket.

Answers

Answer:

1.  GTP dephosphorylation

2.  hydrolyzed or removed

Explanation:

GDP, (Guanosine diphosphate) is a biological term, that is made of composition including pyrophosphate group, a pentose sugar ribose, and the nucleobase guanine and it is made from GTP ( Guanosine triphosphate ) dephosphorylation by the ribonucleotide reductase. This enzyme is inactive when hydrolyzed or removed, and then eventually bound to its master regulatory pocket.

PLEASE ANSWER QUICK!The Greek roots of the word prokaryote mean “before nucleus.” Describe the way that DNA is organized in prokaryotic cells without the help of a nucleus. How does this approach differ from the way that eukaryotic cells organizes their DNA

Answers

Answer:

Prokaryotic cells' DNA are located in the cytoplasm of the cell rather than in the nucleus, like in eukaryotic cells. DNA aids in protein synthesis and determines functions of the cell in cells, regardless of being within the membrane of a nucleus or not.

-----

I hope this helps a little.

The word prokaryote in Greek means before kernel (nucleus). Unlike the eukaryotic cells, the nuclear material is located in the cytoplasm of the cell in a nucleoid.

What are the characteristics of prokaryotic cells?

The prokaryotic cells are the primitive karyons that are defined by the lack of the true nucleus and organelles. Unlike the eukaryotes, the organelles lack the membrane that covers them but has a tough cell wall.

The prokaryotes include archaea and bacteria which are unicellular and microscopic organisms that are simple and have their genetic material organized into nucleoids in the center of the cell. They have the ability to live in harsh conditions.

Therefore, the eukaryotes and prokaryotes differ in the arrangement of the genetic material.

Learn more about prokaryotes, here:

https://brainly.com/question/18348786

#SPJ2

A graduate student studying biology at the University of Nebraska has identified a new species of spider found only in Eastern Nebraska around Omaha. The graduate student determines that the spider has six homologous pairs of chromosomes. How many chromosomes would a cell in that spider have during metaphase of mitosis?

Answers

Answer:

12 chromosomes

Explanation:

Mitosis is a type of cell division that involves the formation of two genetically identical daughter cells. The two daughter cells are genetically identical in the sense that they contain the same number of chromosomes as the parent cell. Mitosis involves four stages namely: Prophase, Metaphase, Anaphase and Telophase.

In the metaphase stage as stated in this question, homologous chromosomes align at the equator of the cell called cell plate, before each chromatids are pulled apart by microtubules at the Anaphase stage.

According to the question, the spider being worked on has 6 pairs of chromosomes, which will align at the cell's equator during metaphase stage of mitosis. Since the replicated chromosomes (chromatids) are yet to separate to opposite poles of the cell, the cell will still contain 12 chromosomes at the metaphase stage.

N.B: Each chromosome contains 2 chromatids or replicated chromosome, which will be separated at the Anaphase stage. Each chromatid will be an individual chromosome after cytokinesis.

The diagram represents a food pyramid. The concentration of the pesticide DDT in individual
organisms at level D is higher than the concentration in individuals at level A because DDT is
A. produced by organisms at level C ingested by
those in level D
B. passed through levels A, B, and C to organisms
at level D.
C. excreted by organisms at level A as a toxic
waste.
D. synthesized by organisms at level D.

Answers

Answer:

The answer is "Choice b".

Explanation:

In the given question diagram is missing. so first, we define the diagram after that we explain why the above given choice is correct.  

In the attached file the food pyramid can be a divide into the level, in which the D pesticides use the "dichloro-diphenyl-trichloroethane ", which concentration is higher than its entities from the level of A because DDT is transferred with species at level D by levels A, B, and C, that's why the choice "b" is correct.  

Which of the following statements is true?
An atom consists of protons, electrons, and
neutrons.
An atom consists of protons and neutrons.
An atom consists of electrons bonded to one
another.
An atom consists of protons bonded to one
another.

Answers

Answer:

An atom consists of protons, electrons, and neutrons.

Explanation:

The atom of an element is its smallest indivisible particle that retains its chemical properties. Atom is the fundamental and basic unit of matter.

The structure of an atom is made up of a positively charged PROTON, a neutrally charged NEUTRON (both contained in the nucleus) and a negatively charged ELECTRON that surrounds the nucleus. These three particles are called sub-atomic particles. The arrangement and number of these sub-atomic particles determine the properties of the atom.

First Question, A, An atom consists of protons, electrons, and neutrons.

Second Question, B, A nucleus consists of protons and neutrons.

edge

which of the following MOST directly influences a measurable outcome in an experiment?

Answers

Answer:

Hello. You did not enter the answer options, but the factor that most directly influences a measurable result in an experiment is the manipulation of the variables.

Explanation:

In an experiment, the manipulation of variables becomes highly important so that it is possible to measure, that is, evaluate the result. This is because it is the variables that express values that represent the characteristics that are being analyzed and studied within the experiment. Therefore, the manipulation between them must be done in a very rational and balanced way so as not to modify the values shown by them, changing the data and generating false or immeasurable data.

Apoptosis differs from necrosis in that necrosis:_______ a. requires the reception of an extracellular signal. b. causes DNA to fragment. c. causes cells to swell and burst, whereas apoptotic cells shrink and condense.d. involves a caspase cascade

Answers

Answer:

c. causes cells to swell and burst, whereas apoptotic cells shrink and condense

Explanation:

These two mechanism are responsible for death of cells in multi cellular organisms.Apoptosis is  naturally occurring process which is well organised and programmed.It is ensures the  automatic death of old and worn out cells, needed for certain cellular developments. This is demonstrated by DNA fragmentation,cell shrinkage,and the break down of the nuclear walls.It can be initiated through two pathways of intrinsic and extrinsic,The latter leads to death from internal factors,while in the former is when external factor causes the death .

However,when cell death is influenced by external factors(toxins)  in the cell environments,which lead to unpredictable or unregulated process leading to cell death ,the process is called Necrosis.it is demonstrated with the swelling and busting of the cell.and characterised with inflammation. It is an accidental death which causes injuries to the cells and tissues.

Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51

What are some of the main characteristics of skeletal muscle cells that make them distinct from the other two types of muscle cells Why are these characteristics important for understanding the function of skeletal muscle?

Answers

Answer:

They are voluntary , require force and fast.

Explanation:

Main characteristics of skeletal muscle cells are given below:

1) these muscles are voluntary which means it can be controlled by the human.

2) skeletal muscles requires force for its movement.

3) movement of skeletal muscle is fast.

Due to its structure, skeletal muscle provide support to the body and the body is able to move from one place to another. It also provide protection to the delicate organs of the body. It is also used as a storage of minerals and fats.

Imagine that plaque uniformly coats the walls of the blood vessel in the diagram. Based on the diagram, what is the reduced area inside the blood vessel? Round your answer to the nearest tenth. The equation for the area of a circle is A = πr2, where A is area, π ≈ 3.14, and r is the radius. Recall that the radius is half of the diameter.

Answers

Hello. You forgot to put the image that complements this question.

The image is attached below:

Answer:

A = 38.465.

Explanation:

To arrive at the result you will have to perform a very simple calculation, using the fromula shown in the question above.

First, it will be necessary to find the diameter of the figure, to

 therefore, you will have to divide, which will result in 3.5.

You can now replace the values in the formula: A = (3.14) (3.5) ² = (3.14) (12.25)= 38.465.

Answer:

12.56

Explanation:

Pleaseeeee help me. When a rabbit eats a plant, nutrients from the
plant become available to the tissues of the
rabbit. During this process, some of the energy
from these nutrients is lost and the energy
becomes heat and unavailable chemical energy.
This energy loss partly explains why the total
energy is greater in
A. predator populations than in scavenger
populations.
B.consumer populations than in producer
populations.
C. producer populations than in consumer
populations.
D. predator populations than in prey populations,

Answers

Answer:

C.

Explanation:

Answer:

C.

Explanation:

total energy is greater in producer populations than in consumer populations

Characteristics of Living Things
7. The basic unit of organization of living things is a(n)
A. atom B. organism
C. cell
D. organ
8. Storing energy obtained from food is an example of
A. evolution B. homeostasis
C. response
D. growth
досвэ ссэ ерэ с
SCB CE CDS c
a cв сссрэ с
свэ ссэ соз с
свэссэ со е
эсвэссэ со с
CB cc CD с
C3 C3 CD
свэссэ CD е
CB CC CD е
CB cC CD е
свэссэ сор
CBS CS D3
СВсса CD с
CBD CCD CD3 G
33 CC.
Ева сср
B3 CCO DOC
Всс CD с
3 cc DSC
93 cca CDC
Во са сра с
35 C3 CDC
ECO Dac
3 C3 CDC
CCO DOC
CCDC
CCS CDS
CCS coac
9. The passing of genes from one generation to another is
A homeostasis
B. response
C. growth D. heredity
10. The main function of reproduction is to
A. have enough male and female to reproduce
B. overpopulate
D. to be able to replace themselves.
C. grow
11. The milkweed plant feeding the caterpillar is an example of
A. interdependency.
C. preparing to die after a long life.
B. reproduction
D. heredity
12. Adaptation is very important to species because it allows them to
A. grow and become successful
C. Die
B. produce offspring better equipped to survive.
D. produce many offspring.

Answers

Answer:

bbbc

Explanation:

all of these were to long so

Which of the following correctly describes the process of Translation?
I. tRNA anticodon bonds to mRNA codon
II. Ribosome bonds to mRNA strand
III. Ribosome reaches a STOP codon and detaches from the mRNA
IV. Each tRNA adds an Amino Acid to the chain as the Ribosome moves along the mRNA
V. Complimentary mRNA strand is made from DNA template

Answers

Answer:

I. tRNA anticodon bonds to mRNA codon

II. Ribosome bonds to mRNA strand

III. Ribosome reaches a STOP codon and detaches from the mRNA

IV. Each tRNA adds an Amino Acid to the chain as the Ribosome moves along the mRNA

Explanation:

Translation is the second process of gene expression in which a protein molecule is synthesized from the information in a mRNA strand. Translation occurs in the RIBOSOME (an organnelle for protein synthesis made up of ribosomal RNA (rRNA) and proteins). The process of translation occurs in three stages viz: Initiation, Elongation and Termination.

Initiation occurs when the ribosome binds to the mRNA strand in the cytoplasm. The mRNA sequence is then read in a group of three nucleotides called CODON by the ANTICODON of a transfer RNA (tRNA). The basis of reading is the complementary base pairing rule i.e. A-U, G-C. Options I and II describes this stage.

In the elongation stage, the tRNA carries an amino acid corresponding to what it reads in the mRNA codon to the growing polypeptide chain. The amino acids bonds to one another via a peptide bond. As each codon is being read, the mRNA gradually moves over the means sequence. Option IV describes this stage.

Elongation stage continues until any of the stop codons (UAA, UAG, and UGA) are finally encountered by the trans in the ribosome. Since, there are no corresponding anticodons that can read the stop codons, they signal the termination of the translation process. The ribosome then detaches from the mRNA sequence. Option III describes this stage.

Note, option V describes TRANSCRIPTION not TRANSLATION.

Describe at least 2 benefits and 2 drawbacks there might be for animal cells (including humans) to make their own food through photosynthesis.

Answers

Answer:

Explanation:

Benefits

Animals will not depend on plant source again for their food but have it produced directly by themselves because photosynthesis will allow animal produce their own food

Animal will get a direct source of energy for their activities. Energy is derived from food consumed after the food has been broken down in the body system of animal. Animal photosynthesis will give animals access to direct source of energy as the product their food.

Demerit

Animal lacks chlorophyll the green. Pigment in plant that light hit on absorption that will enable them to photosynthesis.

Animal lacks ways or mechanism of regulating Carbondioxide in take as in the case of C4 plant and crassulacean metabolic pathway (CAM).

Animals such as human will not have access to varieties of food but stick to photosynthate produced by them.

Applying ACh to the small intestine will cause a smooth muscle ______, which is through activation of ______ receptors.

Answers

Answer:

The correct answer is -  Excitation; and Gi receptors.

Explanation:

ACh or acetylcholine is a secondary messenger that cause excitation by propagate the signal to the muscles from neurons. It is helps in transport the signal from the motor neurons to the muscles.

ACh release from the parasympathetic neurons and can directly excitation to the smooth muscle by binding to the Gi receptors or muscarinic receptors and activate them for excitation and contraction.

Thus, the correct answer is - Excitation; and Gi receptors.

Activity 12-5: A Dihybrid Punnett Square. Consider your answers in the previous question. In a separate piece of paper, solve the Punnett square for a cross between two heterozygous individuals (BbRr x BbRr); write the genotypes of the gametes along the top and the side of the square and fill in the squares.

Answers

Answer:

See the answer below

Explanation:

For each heterozygous parent with the genotype BbRr, the possible gametes are: BR, Br, bR, and br. A set of these gametes from one of the parents will be lined up along the top of the Punnet's square while another set from the other parent will be lined up along the side of the square.

The result is shown in the attached image.

Other Questions
I was told to write "at least 3 pages long." does the 3rd page need to be full? Graham uses a hot water bottle on an injury to his back he incurred playing basketball. He fills the bottle with water that is 100F. After 25 minutes, Graham finds that the bottle has cooled and stops using it. What is the domain and range? Suppose that you have been chosen for a space mission to a distant planet. Due to the length of time you'll be away from Earth you must carry out physical activity every day. On earth your, strength and conditioning trainer has determined you must do 90 minutes of exercise every day. If the vehicle is travelling at 0.80 c how much time, according to a timer on the space vehicle should you be active to meet your physical activity requirement? What faction of a day is 5hrs 20 mine Create a letter of at least 250 words addressed to your newspaper editor that describes your storage options, and give at least three reasons why your option is the best choice. A sales agent, employed by the Sponsor's first-tier, downstream, or related entity (FDR), submitted an application for processing and requested two things: 1) to back-date the enrollment date by one month, and 2) to waive all monthly premiums for the beneficiary. What should you do? Use the table shown in the image! 1. Which equation expresses y in terms of x? A. y=17x B. y=25x C. x=51y D. x=85y 2. What is the charge for renting a machine for 3.5 hours? A. $51.50 B. $59.50 C. $65.50 D. $86.50Please include all work! Citrus fruits may taste sour because they are _____. acidic basic neutral too ripe An HCl solution has a concentration of 0.09714 M. Then 10.00 mL of this solution was then diluted to 250.00 mL in a volumetric flask. The diluted solution was then used to titrate 250.0 mL of a saturated AgOH solution using methyl orange indicator to reach the endpoint.Required:a. What is the concentration of the diluted HCI solution? b. If 7.93 mL of the diluted HCI solution was required to reach the endpoint, what is the concentration of OH- in solution? c. What is the concentration of Ag+ in solution?d. What is the Ksp expression for the dissolution of AgOH? Solve the inequality 2x-5 is less than or equal to -x+12 . Give your answer as an interval. If two 6-sided dice are rolled, what is theprobability of rolling double 2s? Abigail obtained 18.9 grams of calcium carbonate after performing a reaction. From her calculations, she knew she should have obtained 9.9 grams. What was her percent error? Round your answer to one place behind the decimal. Do not include the unit. Sam bought chocolate bars for $1 each, and then sold them for $2 each. How much profit, in dollars, did Sam make for selling each one of the chocolate bars? Show all work to solve 3x2 x 2 = 0. el matrimonio de los peces rojos personajes Bethany sells roses and petunias. The expression 3r+2.5p3r+2.5p3, r, plus, 2, point, 5, p gives the cost (in dollars) of rrr roses and ppp petunias. What is the cost of 777 roses and 888 petunias? \$$dollar sign A spinner contains 3 equal sections: one red, one yellow, and one blue. The possible results of two spins are shown in the tree diagram below. What is P(red, then yellow)? What was the effect of the Supreme Court decision described in thisheadline?DAILY NEWS 1962In Engel v. Vitale,Court Rules ThatSchool Board CannotSponsor PrayerA. School prayers had to be provided by individual religious groups.B. School prayer was banned in public schools across the UnitedStates.c. The decision was reversed by a later Supreme Court ruling thatprotected school prayer as free expression.O D. A new amendment was passed to allow school prayer. A manufacturer of hospital supplies has a uniform annual demand for 80,000 boxes of bandages. It costs $10 to store one box of bandages for one year and $160 to set up the plant for production. How many times a year should the company produce boxes of bandages in order to minimize the total storage and setup costs? I'maSolarPanelCo. manufactures and distributes solar panels in the US market. Two years ago, it had 5 US competitors, but government stimulus in the industry has encouraged 7 new US competitors to enter the market. In these circumstances, I'maSolarPanelCo.'s price for its outputa. can be tailored to exceed the price of its inputs.b. is dictated by the forces of demand and supply.c. can be tailored to meet the price of its inputs.d. can be set by management to maximize profits.