20 or
5. A politician's speech about how homes should be provided to families who cannot
afford them
Author's Purpose
Explain Your Answer:
Write a sentence or two
its

Answers

Answer 1

Answer

Persuade

Explanation:


Related Questions

heat is too dry as water vapor is to​

Answers

Heat is to dry as water vapor is to wet or moist.
Can be either of the two words depends on your grade levels expectations

Which option is a clear example of a non sequitur?

Answers

Answer:

Like going off topic in a conversation

talking about music to a friend but then you start talking abt sports.

Explanation:

I don't know if this helped but I hope it does

Which passage below best
reveals the cultural setting of
"A Piece of String"?
A. And he grew angry, becoming
exasperated, hot and distressed at not
being believed
B. He felt it, consumed his heart over it
and wore himself out with useless efforts.
He wasted away.
C. their wives, walking behind the animal,
whipped its haunches with a leafy branch

Answers

Ummmmm I would need to see the passage in order to answer this :)

The lines "Is there not rain enough in the sweet heavens / To wash it white as snow?" contain an example of... (question based from hamlet)

A. internal conflict

B. simile

C. irony

D. metaphor

Answers

Answer:

The correct answer is B. Simile.

Explanation:

The simile is a word figure, which is generated by the approach or contrastive comparison of two objects or images in order to increase the clarity and effectiveness of a thought.   Like the metaphor, the simile is based on the similarity that is given in a common third; In contrast to the metaphor, the comparison is based on a direct equation of its relation.  Frequent comparisons in literature and poetry are those of animals and people, of natural objects and moral objects, of persons and moral objects, of natural objects and art objects, etc.

Why do you think we still tell tales of Lincoln's commitment to fairness?

Answers

Answer:

I think it so that we don't repeat history, and we learn from our country's mistakes.

Explanation:

Answer:

hfjdkdheshsiejrjrejsjeiehrbrnrnr

In this poem, Walt Whitman writes about how Americans "sing" as they work. What does
he mean? Why does he think that work is like a song?

Answers

Answer:

The happiness of work. America is happy with working.

Explanation:

1.Which sentence has an inappropriate shift in number?

A.The soccer players were thrilled when they won the local tournament.

B.When people enter a theater late, they should find their seats quickly.

C.When Jacob is having a bad day, they talk about it with a friend.

D.Children can make new friends when they join a club or sports team.

Which sentence has an inappropriate shift in person?

A.I like going to cooking class because I get to try new, unfamiliar dishes.

B.When I visited my aunt's farm, you could hear crickets chirping at night.

C.They were unhappy about the new rule, but they agreed to follow it.

D.When my dad was young, children spent more time outside than they do today.


2.Read the sentence containing a pronoun shift error.

Joe and Lucy presented his science project to the school.

Which sentence corrects the error?


A.Joe and Lucy presented its science project to the school.

B.Joe and Lucy presented your science project to the school.

C.Joe and Lucy presented her science project to the school.

D.Joe and Lucy presented their science project to the school.


3.Read the sentence containing a pronoun shift error.

When my dad was a kid, you played outside until the street lights came on.

Which sentence corrects the error?


A.When my dad was a kid, we played outside until the street lights came on.

B.When my dad was a kid, they played outside until the street lights came on.

C.When my dad was a kid, I played outside until the street lights came on.

D.When my dad was a kid, he played outside until the street lights came on.


4.Read the sentence containing a pronoun shift error.

When a baseball player practices, they go to the batting cage everyday.

Which sentence corrects the error?


A.When a baseball player practices, we go to the batting cage everyday.

B.When a baseball player practices, he goes to the batting cage everyday.

C.When a baseball player practices, it goes to the batting cage everyday.

D.When a baseball player practices, you go to the batting cage everyday.

Answers

Answer:

1. C

2. C

3. A?

4. C (you weren't even looking to be born cause your dad was a juvenile. YOUR DAD MUST HAVE DID SOMETHING REALLY BAD

5.D?

Explanation:

The answer to the given question regarding the shift in pronoun would be as follows:

Find the Pronoun Shift error?

1). The sentence that contains an inadequate shift in number would be:

C. When Jacob is having a bad day, they talk about it with a friend.

- The sentence that has an incorrect shift in person would be:

B. When I visited my aunt's farm, you could hear crickets chirping at night.

2). The sentence that rectifies the pronoun shift error would be as follows:

D. Joe and Lucy presented their science project to the school.

3). The sentence that corrects the pronoun shift error in the sentence is:

D. When my dad was a kid, he played outside until the street lights came on.

4). The sentence that corrects the error of pronoun shift would be:

B. When a baseball player practices, he goes to the batting cage every day.

Learn more about "Pronoun Shift" here:

brainly.com/question/18479735

Twenty points and brainliest!!! Read this passage(picture). Which answer best identifies a clue that the overall organizational structure of this passage is order of importance?

A: the fact that the passage begins with the transitional phrase “most importantly”

B: the fact that the author urges the reader to not listen to other people

C: the fact that it contains two rhetorical questions

D: the fact that the author recognizes that some dreams will never become reality

Answers

Answer:

B

Explanation:

I NEED HELPP!!! Whats the summary for this article

Answers

Answer:

The answer is below

Explanation:

Addidas, a multinational company has made it known that they want to go into the production of leather material free from mycelium and they'll start its utilization with footwear production.

In recent years, Addidas have been trying to move from the production of footwear made of animal skin. This has even made them have a deal with some others to produce footwear made of recycling products. This will be part of their goals to achieve 60% production made of sustainable materials in 2021.

To achieve this goal, Addidas are now in partnership with Bolt Threads. A company that has the likes of John Legends as part of their investors.

This goal of producing footwear from sustainable material is part of the world's larger vision 2050 which is to reach climate neutrality.

I need to write an email to cancel the IB test I registered for. Please help I am not good with emails

Answers

Answer:

Dear,  (Teacher or whoever)          

        Hello, I am (your name) and I am writing this to cancel the IB test I have registered for. I need to cancel because  (List your reasonings)

Explanation:

I am not the best either.

i dont know how to write an email and i dont even know what that test thing is  i just need some point things

Any writing that reads the same forward or backward is a. IM IN QUIZ PLS GET IT ASAP!!!


A. Palindrome
B. Limerick
C. Pun
D. Conundrum

Answers

Answer:

A. Palindrome

Palindrome which is A is the correct answer .


Who does Odysseus see in the underworld?
a. Laertes
b. Polyphemus
c. Anticleia
d Antinous

Answers

Answer:

C

Explanation:

Why does Jing-Mei feel like she doesn’t know her mother?

Answers

Jing-Mei's mother feels that she is doing everything she can to provide opportunities for her daughter. When Jing-Mei through a temper tantrum about the piano lessons it upset her mother. Her mother felt that her daughter did not appreciate what she was trying to do for her.

Answer:

Jing-Mei's mother feels she is doing everything possible to provide opportunities for her daughter. When Jing-Mei through a temper tantrum about the piano lessons, it upset her mother. Her mother felt that her daughter did not appreciate what she was trying to do for her.

Explanation:

Change the following sentences from direct to indirect speech.

a) ‘Congratulations! You have come first in the exams,’ the principal said to

me.

b) Mohit’s father said, ‘We must not watch TV while having our dinner.’

c) ‘What an expensive car he drives!’ remarked Rahul’s neighbour.

d) ‘How well you speak German,’ his teammate remarked.

e) ‘Hurry up!’ said Viru’s mother. ‘The bus will be here in a minute.’

f) The policeman ordered the truck driver, ‘Show your licence.’

g) ‘You will have to surrender your passport,’ the officer said to the passenger.

h) My grandfather said, ‘May you have a long life!’

i) Mr Jain said to his colleague, ‘Will you please drop me at the airport?’

j) ‘Light travels in a straight line,’ the teacher explained.

k) ‘I saw an interesting film last evening,’ said my friend.

l) The caller asked, ‘May I speak with Shweta?’

m) ‘May I know who is on the line?’ her father enquired.

n) ‘Ouch! The bee stung me!’ the child said​

Answers

Explanation:

-the principal congratulated me for coming in the first place.

-mohits father said that we must not watch tv while having dinner

-rahuls neighbour remarked the expensive car he drives

Part A
How does Poe use a narrative structure to create meaning and effect in "The Raven e?
Hint: Try grouping the stanzas by similarity of events and classify them as part of the exposition (introduction to the
narrative), rising action, climax, falling action, or resolution.

Answers

Answer:

He emphasizes the setting of the story by using events and powerphrases as a way to do it.

Explanation:

Answer:

The narrative structure uses the first two stanzas to establish the setting and mental state of the narrator. The narrative structure creates a spooky and mysterious mood. The remaining stanzas build the story by describing events that create rising action, climax, falling action, and resolution.

Explanation:

Exact Sample Answer on Edmentum

what type of figurative sentence is this
the sneaky snake slithered slowly ​

Answers

Alliteration is the figurative language for those types of sentences

Answer:

Alliteration is the figurative language for those types of sentences

Example:

Butterflies bring beauty by floating in the breeze.

What does the suffix -able mean?

capable of being

cause or become

the action of

full of

Answers

it is “capable of being “

Answer:

The answer would be "Capable of being"!:)Have a nice day!

u guys help me brainliest if it's right

Answers

Answer:

Selection 2, 3 and 4. August listens to his mom, August agrees to tour the school and August asks questions.

Answer:

I would say b,c,d are correct , sorry if im wrong

PLEASE HELP !!!! :((((
‼️I WILL MARK BRAINLIEST‼️
10 POINTS


Which statement best explains how the infinitive is used in the sentence?

I read an excerpt from the biography about Dr. Seuss to learn more about how he wrote creative children's stories.

A. The infinitive from the biography works as an adjective in the
sentence

B. The infinitive how he wrote works as a verb.

C. The infinitive to learn acts as an adverb in the sentence.

D. The infinitive about Dr. Seuss modifies the noun biography

Answers

C) The infinitive to learn acts as an adverb in the sentence

Answer:

C

Explanation:

1. Choose a topic:
• how colors make you feel
body and mind
2. Choose a way to express yourself:
• a song
.
• a poemi
• a piece of graphic art
3. Present your work.

Answers

Answer:

this question is asking you to express yourself, so our help wouldnt be of much help.

Explanation:

Yo you should write a song... abt like diff colors

Second-person point of view features the narrator speaking directly to the reader. the use of the pronouns “I,” “me,” and “my.” the use of the pronouns “he,” “she,” and “they.” the thoughts and feeling of all the characters.

Answers

Answer:

So i'm not sure  what your exactly trying to ask, but The pronouns, "I", "my", and "me" are actually first - person point of view. And the pronouns, "he", "she", and "they" are Second - person point of view. So i think you have them mixed up. hope this helped :)

Explanation:

Answer:

TA-DAAA ❤️❤️❤️

Explanation:

Abomination in a SIMPLE SENTENCE
(Please help)

Answers

Answer:

the cruel treatment of prisons was abominable

means the same thing

Answer:

Anyone who commits an extreme and serious crime such as being a murderer is an abomination to society.

Though she tried to like Halloween, Heather saw it as an abomination and despised all October 31st festivities.

You're an abomination if you like more salt than sugar in cookies.

What is the Web site's purpose? O to inform to persuade to entertain​

Answers

Answer:

The Answer is to Inform

Is the driving age should be raised for three clear reasons an ineffective claim

Answers

Answer:

probably

Explanation:

Answer:

No, it is effective.

Explanation:

it establishes the claim, precedent, and author’s viewpoint- it’s also an introductory text, so it’s perfect. However, it should be followed by bullet points or clear, simple reasoning.

The main idea is usually found in the
sentences of a paragraph.
O A. first or last
B. middle
O C. first
O D. last

Answers

the main ideas is normally found in the middle

help me out with this please ​

Answers

Answer:

Number 1 is Entertain because it is like a story

Explanation:

Number 2 is to Persuade because the author is trying to tell you to recycle to help your community out.

Hope this helps

Oh Mother Nature how we tremble to the wrath that you have bestowed upon us

What figure of speech​

Answers

Personification because the sentence is giving an idea human like qualities ( bestowing wrath upon humans)

how were the boats that set sail thousands of years ago like modern spaceships ?

Answers

Answer:

they allowed people to travel places they couldn't before

Please need help fast will give brainleist
Think of a culture you have always wanted to know more about. Write a brief summary of what you do know about the culture and what you find interesting. (The culture could exist now or in the past.)

Answers

I have always been intrigued by Hinduism. What I know of it is very little. I am knowledgeable on the fact that they meditate and worship Buddha. Other than that I do not know much more, one day I wish to know more about their religion and way of life.

Please answer this question

Answers

answer:

it’s B

explanation:

the other ones are not mentioned in the story i think
Other Questions
Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Which number is a reasonable estimate for 637x35? Square ABCD has diagonals AC and BD . What is mABDA180B90C45D360 complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone.