18. Jeff traveled at an average speed of 65 miles per hour for 2.5 hours and then traveled at an average speed of 70 miles per hour for 1.5 hours. What was the total distance in miles that Jeff traveled during this time?

A 272.5
B 267.5
C 270
D 337

Answers

Answer 1

Answer:

B) 267.5

Step-by-step explanation:

162.5+105=267.5


Related Questions

Which of these rational numbers is also an integer?
A - 2/4
B - 0.24
C - 4/2
D - 2.4

Answers

D because its a whole number thats not a fraction

You're given two side lengths of 10 centimeters and 8 centimeters. The angle between the sides measures 40°. How many triangles can you
construct using these measurements?
A. 0
B. 1
C. 2
D. Infinitely many

Answers

Answer:

B. 1 triangle only!

Step-by-step explanation:

Since the angle and the sides are fixed!

The function Y=4.75+2.20(X-1) can be used to determine the cost in dollars for a taxi ride in Houston, TX. What is the rate of change of the cost in dollars with respect to the number of miles?

Answers

Answer:

2.20 dollars/mile

Step-by-step explanation:

Given the function:

y = 4.75 + 2.20(x-1)

Before we get the rate of change of the cost, we need to write the expression in the form y = mx+c where;

m is the rate of change of the cost

From the function given:

y = 4.75 + 2.20(x-1)

Open the parenthesis

y = 4.75 + 2.20x -2.20

y = 2.20x + 2.55

On comparing with the standard

m = 2.20

Hence the rate of change of the cost in dollars with respect to the number of miles is 2.20 dollars/mile

Germany, Italy, and Japan formed the Tripartite Pact in part because they:

Answers

Answer:

hoped to convince the United States to stay out of World War II

Explanation:

just took the quiz :)

Answer:

Wanted to support one another in conquering Europe and Asia

Step-by-step explanation:

Please help ASAP!
The perimeter of a rectangle is 48 inches. The length of the rectangle is three times the width of the rectangle. What is the area of the rectangle?
A. 24
B. 54
C. 108
D. 432

Answers

Answer:

108

Step-by-step explanation:

108!!!! hope this is correct :)

answer it please. brainliest if correct​

Answers

the answer is x=4 & y=3
X=4 and y=3



Hopes this helps

i will mark brainlyest plss helpp
Which table has a constant of proportionality between yyy and xxx of 0.30.30, point, 3?

Choose 1 answer:

Choose 1 answer:


(Choice A)

A

xxx yyy

666 222

121212 444

303030 101010


(Choice B)

B

xxx yyy

333 1.81.81, point, 8

777 4.24.24, point, 2

999 5.45.45, point, 4


(Choice C, Checked)

C

xxx yyy

444 1.21.21, point, 2

888 2.42.42, point, 4

131313 3.93.9

Answers

Answer:

The answer is C

Step-by-step explanation:

i also use khan

Answer:

table C

Step-by-step explanation:

each one is multiplied by .30

:)

12x-20=n(3x-5) what does n equal​

Answers

The answer is 4 do you need a step by step explanation or no
the answer is 4 because 12x-20 =4(3x-5)

What is the range of the mapping?

Answers

The range of the mapping is 1,4

Please help me I’m begging u it’s due in 10 minutes!!

Answers

Answer:

y= -1

Step-by-step explanation:

subtract, so x cancels out.

you are left with 2y=-2

y= -1

Answer:

y = - 1

Step-by-step explanation:

x + y = 1 .......... (1)

x - y = 3 .......... (2)

(1) + (2)

2x = 4 ⇒ x = 2

2 + y = 1 ⇒ y = - 1

(2, - 1)

Which equation can be used to determine the number of movie tickets sold if the cost of each ticket x was $5.50, and $6,850 was earned on the ticket sales?

Answers

Answer:

5.50x = 6,850

Step-by-step explanation:

Each ticket costs $5.50, and the total is $6,850.

Hope this helps! :)

Gary sold 8 more tickets than Peter. Tracy sold 12 less than Peter. They sold 50
tickets in total. How many tickets did Gary sell?

Answers

Answer:

96 tickets

Step-by-step explanation:

Quadrilateral E F G H is shown. Angle E is (15 x minus 10) degrees, angle F is (15 x + 14) degrees, angle G is (9 x minus 4) degrees, and angle H is (11 x + 10) degrees.
What is the greatest angle measure in the diagram?

95o
105o
119o
180o

Answers

Answer:

119

Step-by-step explanation:

Answer:

C. 119 degrees

Pleaseee help!!!!!!!!

Answers

Answer:

no

Step-by-step explanation:

no


Find the equation of the line with m = 2 and goes through (-4,5).PLEASE HELP

Answers

The Equation is y=+5
Why:

You want to find the equation for a line that passes through the point (-4,5) and has a slope of .
First of all, remember what the equation of a line is:
y = mx+b
Where:
m is the slope, and
b is the y-intercept
To start, you know what m is; it's just the slope, which you said was . So you can right away fill in the equation for a line somewhat to read:
y=x+b.
Now, what about b, the y-intercept?
To find b, think about what your (x,y) point means:
(-4,5). When x of the line is -4, y of the line must be 5.
Because you said the line passes through this point, right?
Now, look at our line's equation so far: . b is what we want, the 0 is already set and x and y are just two "free variables" sitting there. We can plug anything we want in for x and y here, but we want the equation for the line that specfically passes through the the point (-4,5).
So, why not plug in for x the number -4 and for y the number 5? This will allow us to solve for b for the particular line that passes through the point you gave!.
(-4,5). y=mx+b or 5=0 × -4+b, or solving for b: b=5-(0)(-4). b=5.

a. The sum of a number and one is equal to one added to the number.

Answers

Equal to the number that your didviding or multiplying

Lauren is tutoring students at the library on Saturday. If she is at the library for a total of 6 hours and she helps each 3 student, one at a time, for 7 of an hour, how many students does she tutor?
6
8
12
24​

Answers

Answer:

24 hope this helps

Step-by-step explanation:

how do I work this out

Answers

Do 4x4 which equals 16 and that’s your answer hope this helps

Answer:

16

Step-by-step explanation:

4 x 4

a forest covers 47,000 acres. a survey finds that 0.2% of the forest is old growth trees. How many acres of old growth are there?

Answers

Answer:

9400

Step-by-step explanation:

I'm not really sure if this is right but I changed 0.2% to 1/5 and 1/5 is 9400. Hope this is right!

Which of these expressions equal 15 when x=1/2 and y=3? Circle all that apply. Please help with this my teacher need me to work out xy+3 1/2+20x Btw guys 3 1/2 are mixed numbers if your wondering

Answers

Answer:

15

Step-by-step explanation:

First you would replace the x and y's with 1/2 and 3.

So it would look like: (1/2) (3) + 3 1/2 + 20 (1/2)

Next, you go by PEMDAS (parenthesis, exponents, multiplications, division, addition, subtraction)

So you would first multiply and the parenthesis that I added mean multiplication.

1.5 + 3.5 + 10

So then all that is left to do is add because I multiplied everything out.

So it is 5 + 10 which is 15

Select the expression that is equivalent to 18 : 12 A) 6 (8+6) B 12 (4+1) C 4 (443) D 8(6+4)

Answers

Answer:

Step-by-step explanation:

D 8(6+4)

What is the distance from –8 to 4 on a number line?

Answers

Answer:

13 away

i used my fingers

Answer:

12

Step-by-step explanation:

-8_-7_-6_-5_-4_-3_-2_-1_0_1_2_3_4

Just count he bottom lines

If Aaron tunes into his favorite radio station at a randomly selected time, there is a 0.20 probability that a commercial will be playing.

b. If Aaron tunes into this station at 5 randomly selected times, will there be exactly one time when a commercial is playing?

Answers

Answer:

Yes, there will be with a probability of 0.4096

Step-by-step explanation:

Given,

p = 0.2

1 - p = 0.8

Number of trials, n = 5

P(x = 1)

Using the binomial probability formula :

P(x =x) = nCx * p^x * (1 - p)^(n - x)

P(x = 1) = 5C1 * 0.2^1 * 0.8^4

P(x = 1) = 5 * 0.2^1 * 0.8^4

P(x = 1) = 0.4096

Yes, there will be with a probability of 0.4096

Answer:

No. If Aaron tunes into this station at 5 randomly selected times, there will not necessarily be exactly one time when a commercial is playing.

Step-by-step explanation:

trust

are the two triangles congruent ?

A. yes
B. no
c . there not enough information to say ​

Answers

Answer:

no

Step-by-step explanation:

if 50% is 7 what is 25%, 75%, and 100%​

Answers

Answer:

100% = 14

75% = 10.5

25% = 3.5

Answer:

100% = 1475% = 10 1/250% = 725% = 3 1/2

Step-by-step explanation:

50% if a number is also 1/2 of that number. So, we multiply 7 by 2 to get 14.

Now we know that we need to solve for 25%, 75%, and 100% of 14.

100% of a number is just that number, so 100% of 14 is 14.

To solve for 75% of 14, we multiply 3/4 by 14.

3/4 x 14/1 = 42/4 = 10 1/2

The final number to solve for is 25% of 14.

1/4 x 14/1 = 14/4 = 3 1/2

(please will someone help me please). write the equation of the line in the graph the two points on the line are located at (0, 3) and (6,-1) multiple choice answers are . Y=3x. Y=1/3x+3. Y=2/3x+3. Y=-6x​

Answers

Answer:

c) y=2/3x+3

Step-by-step explanation:

im pretty sure this is right :)

Could you describe the expression 2(3+4) as a product of two factors?​

Answers

the answer will be 10 just multiply the numbers

PLEASE ANSWER ASAP FOR BRANLEST!!!!!!!!!!!!!!!
Solve the equation
9(k - 2) = -6
what is k?

Answers

Answer:

k= 4/3

Step-by-step explanation:

distribute 9     9k- 18=-6

add 18 to both sides  9k= 12

divide by 9

The value of k is 4/3 or 1.334.

What is Equation?

A statement that supports the equality of two expressions that are connected by the equals sign "=" is an equation.

An equation is a condition on a variable in algebra. It only holds true for a specific value of the variable.

Polynomial equations and linear equations are two prominent families of equations that algebra takes into account.

Given equation

9(k - 2) = -6

9k - 18 = -6

add 18 both sides

9k - 18 + 18 = -6 + 18

9k = 12

k = 12/9 =4/3 = 1.334

Hence the value of k is 4/3 or 1.334.

Learn more about equation;

https://brainly.com/question/29657983

#SPJ2

5. Si un paquete de 100 hojas iguales mide 1 cm de altura, ¿cuál


es el grosor de una hoja?

Answers

Responder:

0,01 cm

Explicación paso a paso:

Dado que :

Un paquete de 100 hojas iguales = 1cm de alto

Esto significa que el grosor del paquete es de 1 cm de alto.

Dado que las hojas son iguales, el grosor de una sola hoja será:

(Espesor del paquete completo / número de hojas en el paquete)

(1 cm / 100)

= 0,01 cm

Usando proporciones, se encuentra que el grosor de una hoja es de 0.01 cm.

Esto problema é solucionado por proporciones, se utilizando de una regla de três.

Hay 100 hojas iguales, al todo midiendo 1 cm de altura. ¿Cuál es la equivalente medida de 1 hoja?

La regla de três es dada por:

100 hojas - 1 cm

1 hoja - x cm

Aplicando multiplicación cruzada:

[tex]100x = 1[/tex]

[tex]x = \frac{1}{100}[/tex]

[tex]x = 0.01[/tex]

Por eso, el grosor de una hoja es de 0.01 cm.

Un problema similar, que también envolve proporciones, es dado en https://brainly.com/question/24615636

PLEASE help me. thank you

Answers

Answer:

Each paper weight is half a pound

Step-by-step explanation:

Other Questions
Describe the three specialized systemic routes. Fill in the blanks!!(Will be given brainliest for the correct answers) rectanglerhombussquareisosceles trapezoid A laundry basket has 24 t-shirts in it. Four are navy, twelve are red and the remaining are white. What is the probability of not selecting a red shirt? * Aisha wants to paint the four walls of her living room. Each wall is 2.4 m high and 3.7 m long.One wall has a door of 2 m by 0.7 m. Tins of paint cost 12 per 1.5 L tin. Each litre of paint can cover 8 m2 of wall. There is an offer of: Buy 2 tins get the 3rd at half price. How much will Aisha pay to paint her living room? What is the lcm of 6/8 and 4/32? Determine the absolute pressure on the bottom of a swimming pool 30.0 mm by 8.4 mm whose uniform depth is 1.9 mm . How long does it take a train traveling at a constant rate of 50 miles per hour totravel 350 miles?5 hours300 hours7 hours175 hours While filming the video documentary The March of the Penguins, what did French director Luc Jacquet choose to do that enabled him to work outside of the documentary genre? According to this article, how does this movie fit the description of a video documentary presented in the lecture? (site 1) Which of the following is NOT a possible verdict following jury deliberations?A.guiltyB.not guiltyC.delayed decisionD.hung jury NEED HELP FAST PLEASEEE!! What is greater than 4.026 The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA