1. Viruses such as avian (bird) flu and swine flu that mutate and can spread from animals to human populations are known as what?
O A. Vectors
O B. Transmuting viruses
O C. Epidemics
O D. Zoonoses

Answers

Answer 1

Answer:

B

Explanation:

they are transmuting viruses

Answer 2
B. Transmuting viruses is the answer

Related Questions

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

Examine the following diagram. Place the labeled layers in order from youngest to oldest.

Public Domain

A, B, C, D
C, D, B, A
D, A, B, C
C, B, A, D

Answers

Answer:

C, D, B, A

Explanation:

Got it right on the quiz. Also the definite order would be that D HAS to be before A and B and only the second option has that since C is lava which is the most recent.

answer answer answer answer

Answers

Answer: C

Explanation: Amoeba use pseudopods to move around and people use feet to move.

Answer:

The answer is C

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.

Answers

Complete Question:

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.      

Tree-dwelling primates have prehensile tails for gripping branches. Tree-dwelling opossums also have prehensile tails.  Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues.    Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.  Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live. Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.

Answer and Explanation:

Tree-dwelling primates have prehensile tails for gripping branches.  Considering recent ancestors, the prehensile tail trait can be considered as a convergence example that occurred among different groups. But we can also think about it as a common descent if we consider the farthest primates ancestor. Although still controversial, Plesidiapsi might be considered a common ancestor of primates, that evolved from a ree-dwelling mammal with a long tail. It is believed that this animal used to live in trees.   Tree-dwelling opossums also have prehensile tails.   Convergence. Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues. Convergence. These are two groups that are very separated from each other, and they developed different traits according to their needs separately. Some of the species of these two groups adapted to feed on the same plant so they needed to develop the same characteristic to obtain nectar.Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.   Common descent . The common ancestor had a prehensile tail, some of the descendants developed the tail but some others did not.Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live.  Common descent . Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.  Common descent . They all look like the finch-like ancestor.

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Which would have a bigger effect on an organism, an error during transcription or a point mutation?

Answers

Answer: Point mutation would have a bigger effect on an organism.

Explanation:

a) dry apricots are left transferred to sugar solution?

Answers

When dry apricots are left for sometime in pure water, they will swell. Because, water will enter into them through the process of osmosis. Later,when these apricots will be transferred to sugar solution, they will again shrink.

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

The narrative point of view in this excerpt allows the
reader to experience
O Rainsford's feelings as he enters the room.
Rainsford's feelings about his host.
Rainsford's impression of the dining room.
O Rainsford's impression of the island.

Answers

Answer:

O Rainsford's impression of the dining room.

Explanation:

Richard Connell's short story "The Most Dangerous Game" revolves around the famed hunter Sanger Rainsford and his change of fortune when he was left stranded in an island famed for hunting humans as a game by the island's barbaric owner General Zaroff.

In the given excerpt, the narrator reveals the "dining room to which Ivan conducted (Rainsford)". The impression that the hall was "of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat" reveals the outline of the enormous dining hall where Rainsford was conducted to eat with Zaroff. This narrative point of view allows the reader to experience the impression of the dining room.

Answer:

C

Explanation:I took the quick on Ed (:

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

why do solids have a fixed shape

Answers

Answer: solids have fixed shape because they are rigid and is high dense. The particles are way too close to each other that even force applied to it doesn’t change it shape

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Other Questions
If a stock has a preemptive right, it gives current stockholders the right to purchase any new shares issued by the firm, so as to maintain their level of ownership. This right helps protect current stockholders against both dilution of control and dilution of value.a. Trueb. False What is the ambiguity technique in literature? Calculate how many different sequences can be formed that use the letters of the given word. Leave your answer as a product of terms of the form C(n, r). HINT [Decide where, for example, all the s's will go, rather than what will go in each position.] georgianna A) C(10, 7) B) C(2, 10)C(1, 8)C(1, 7)C(1, 6)C(1, 5)C(2, 4)C(2, 2) C) C(10, 2)C(8, 1)C(7, 1)C(6, 1)C(5, 1)C(4, 1)C(3, 1)C(2, 1)C(1, 1) D) 10 C(10, 2)C(8, 1)C(7, 1)C(6, 1)C(5, 1)C(4, 2)C(2, 2) E) C(10, 2)C(8, 1)C(7, 1)C(6, 1)C(5, 1)C(4, 2)C(2, 2) Health-related fitness is to health as skill-related fitness is to _____. What is the image of (7, -2) after a reflection over the line y = -x? The net income reported on the income statement for the current year was $121,900. Depreciation recorded on store equipment for the year amounted to $20,100. Balances of the current asset and current liability accounts at the beginning and end of the year are as follows: End of YearBeginning of Year Cash$48,030 $44,190 Accounts receivable (net)34,440 32,660 Merchandise inventory47,020 49,710 Prepaid expenses5,280 4,200 Accounts payable (merchandise creditors)45,000 41,800 Wages payable24,590 27,310 a. Prepare the Cash Flows from Operating Activities section of the statement of cash flows, using the indirect method. Use the minus sign to indicate cash outflows, cash payments, decreases in cash, or any negative adjustments. Statement of Cash Flows (partial) Cash flows from operating activities: $ Adjustments to reconcile net income to net cash flow from operating activities: Changes in current operating assets and liabilities: Net cash flow from operating activities$ b. Cash flows from operating activities differs from net income because it does not use the of accounting. For example revenues are recorded on the income statement when . Where is the punctuation error in this sentence? I am delighted to1 introduce Dr. Anna Smith,2 a psychiatrist3 who will talk to us about parent-child4 relationships. Select a scene from any film with at least two characters in the scene, Re-tell the scene from each person's perspective.Please help!!!!!!! Justin is married with one child. He works 40 hours each week at a rate of $16 per hour. His wife began working part timeafter their daughter was born, but still contributes about $350 to the cash inflow each month. Their monthly cash outflowis generally about $3,000. They have a balance of $2,000 in their savings account. Justin has retirement contributionstaken out of his paycheck at work. They have renter's, car and life insurance coverage.Based on this information, what part of their financial plan should Justin and his wife work on?managing incomeb. managing liquidityc. protecting assetsd. retirementa.Please select the best answer from the choices provided Joey went for 15 auditions. Out of those 15 auditions, he got called back for 30% of them. Approximately how many did he get called back for? Describe the motion of water waves. A companys perpetual preferred stock has a par value of $65 per share and it pays a dividend rate of 6.25% per year. The preferred stocks market value is $58.63 per share and the companys tax rate is 31%. If the flotation costs for preferred stock are 6.5%, what is the companys annual cost of new preferred stock financing? What is one main reason some governments in the twentieth century began campaigns of genocide? Which of the following gulfs are in Southeast Asia? A. the Gulf of Aden and the Gulf of Bahrain B. the Gulf of Mexico and the Gulf of California C. the Gulf of Thailand and the Gulf of Tonkin D. the Gulf of Suez and the Gulf of Oman Calculate the entropy change in the surroundings associated with this reaction occurring at 25C. Express the entropy change to three significant figures and include the appropriate units. Which line(s) from the poem show the reader that the poet is not just makinga statement about trees?OA. Now, of my threescore years and ten/ Twenty will not come again,B. And stands about the woodland ride/Wearing white forEastertide.) C. Loveliest of trees, the cherry now/ Is hung with bloom along thebough.OD. About the woodlands I will go/To see the cherry hung with snow. Use A = -h(a + b) to find the area A of a2be trapezium when a = 15, b = 9 and h = 7 use the word "play " as both noun and verb and make sentences. Which theme best reflects the ideals of modernist writers? A: Nature can heal an ailing spirit B: Hard work breeds financial success C: A person doesn't find love; love finds the person D: The ideal has the capacity to disappoint Please and Thank you all for your help! fremont which uses the high-low method reported total cost of $10 per unit its lowest production level, 5000 units. when production tripled to its highest level, the total cost per unit dropped to $5 variable cost per unit