1 point
7. In the wild, rabbits breed very quickly producing many offspring in a
short period of time. Which of the following is most likely the reason why
rabbits have adapted the ability to breed quickly? *
There are many diseases that wipe out entire rabbit populations
O They have limited habitats that they live in
There is limited food in most habitats
O They have many predators and short life spans

Answers

Answer 1

Answer:

they have short life spans and many predators.. hope this works


Related Questions

triangular shaped land mass found on land ​

Answers

Answer:

beautiful

Explanation:

serioudly I like it

Deltas are beautiful landforms, especially when viewed from above. Roughly triangular in shape, deltas are full of complex, wonderful detail: swirling, multi-colored sediments broken by serpentine, miniature river channels.

HELP QUICK HELP ILL MARK U BRAINLIST

Answers

Answer:

B or A I think B

What is seed dispersal? Name some agents of seed dispersal​

Answers

Answer:

The Process by which seeds spread over a wide area is known as seed dispersal..

some agents

Air

water

animals

etc..

Answer:

Seed dispersal is the movement, spread or transport of seeds away from the parent plant.

The most common methods are :

wind, water, animals, explosion and fire.

FIND THE INDEPENDENT & DEPENDENT VARIABLE!

- the amount of iron in blood depends on the amount of red meat a person eats.

Answers

Answer:

The answer is:

Independent: red meat eaten by a person

Dependent: iron in the blood

Explanation:

A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.

please help with this question​

Answers

Answer:

a -5

d -2

c-3

b-4

e - 5

Explanation:

I'm guessing this is the answer

A farmer has been trying to increase his crop yield for the last 10 years by
adding about 25% more fertilizer to his crops than he needs. What will most
likely result from this action?
Select one:
a. Increased crop yields.
b. Air pollution from the excess fertilizers
c. Soil degradation form the excess fertilizers
d. The additional fertilizer will have little to no impact.

Answers

Answer:

The correct answer is - b. Air pollution from the excess fertilizers

Explanation:

In long term using excess amount of fertilizer than requirement will lead to several condition such a soil acidity, soil degradation, soil leacing, eutrophication of waterways and many but more improtant is green house gases and air pollution.

Using the excess amount of fertilizer does not help in increasing crop yield but gives negative impact. Using fertilizer more than requirement wil lead to release of toxic and harmful gases in atomosphere and fuming.

The picture shows respiratory epithelium in the lungs. The cilia, or fingerlike projections are MOST LIKELY there to
A)
move liquid.
B)
catch debris.
C)
secrete mucus.
D)
transmit impulses

Answers

Answer:

B. catch debris in the lungs

B. Catch debris would be the answer

Order the levels of organization of living things. (Order the levels starting from top to bottom with the smallest at
the top)
biome
species
biosphere
population community
ecosystem


WILL GIVE BRAINLIEST

Answers

1 population
2 species
3 economists
4 biome
5 biosphere

23. In both plant and animal cells, the cell
membrane
(1) produces enzymes
(2) controls reproduction
(3) is composed of sugars

(4) regulates diffusion

Answers

Answer:

the answer is option 1

The Cell membrane regulates diffusion, in plants and animal cells.

What is a Cell Membrane?Every biological cell has a thin membrane that separates it from the rest of the environment this membrane is known as a cell membrane.Cell membranes is made of lipids and proteins.The cell membrane's chemical nature makes it extremely flexible, making it a perfect border for quickly growing and dividing cells.Cell membrane is a semi-permeable membrane.

Cell membrane does not produce enzymes.

Hence, the option (1) is incorrect.

Cell membrane cannot control reproduction.

Hence, option (2) is incorrect.

The main constituents of cell membrane is lipids and proteins, not sugars.

Hence, option (3) is incorrect.

Cell membrane regulates diffusion, because the cell membrane contains the semi-permeable membrane which allows only lipids and certain small molecules in the cell.

Hence, option (4) is correct.

Therefore, the Cell membrane regulates diffusion, in both plants and animal cells.

Learn more about the Cell Membrane here: https://brainly.com/question/14290615

#SPJ2

To find new and alternative farming methods and practices, private companies often fund their own research and development teams.


False

True

Answers

I think the answer is false

:):):):):)

Answer:

FALSE ALL DAY LONG

Explanation:

Provide at least 1 example of a mutation
that does not have a negative effect on
the individual.
PLEASE HELP ME

Answers

i honestly don’t know but i’m guessing maybe having more fingers or something

1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?​

Answers

Answer: 1. The nitrogen cycle is a biogeochemical cycle.

2. The carbon cycle is a biogeochemical cycle.

Explanation:

1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.

2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.

Please also describe how actin-binding sites are made available for cross-bridging with myosin heads during contraction.

Answers

Answer: The calcium ion binds to troponin, and this slides the tropomyosin rods away from the binding sites.

Explanation:

Contraction and relaxation of muscle cells brings about movements of the body. The contractile myofilament called sarcomeres are bounded at each end by a dense stripe called the Z - line, to which the myosin fibres are attached, and lying in the middle of the sarcomere are the actin filaments, overlapping with the myosin.

When action potential spreads from the nerve along the sarcolemma (muscle cell membrane), it penetrates deep into the muscle cell through the sarcoplasm (cytoplasm of muscle cell), and releases CALCIUM from the intracellular stores.CALCIUM triggers the binding of myosin to the actin filament next to it forming CROSS BRIDGES.

For this to occur, ACTIN BINDING SITE has to be made available. TROPOMYOSIN is a protein that winds around the chains of the actin filament and covers the myosin-binding sites to prevent actin from binding to myosin. The first step in the process of contraction is for calcium ions to bind to troponin so that tropomyosin can slide away from the binding sites on the actin strands.

What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences​

Answers

Answer:

A

Explanation:

I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.

PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.

Answers

It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.

What are the important factors for the experiment?

This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:

Acceleration: This factor is the one you will measure in your experiment.

Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.

Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.

Steps for the experiment:

Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.

Throw different objects with different masses: You can begin with light objects and move into heavier objects.

Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.

Learn more about acceleration in:

brainly.com/question/12134554

#SPJ1

Earth makes one full rotation on its axis approximately every 24 hours. If Earth's period of rotation decreased to 20 hours, which of the following changes would occur?


There would be fewer days in a week.


The length of nighttime would increase.


It would take Earth longer to revolve around the Sun.


The length of daylight and nighttime would decrease.

Answers

Answer:

The length of daylight and nighttime would decrease.

Explanation:

If 24 hours was decreased to 20, it would shorten night and day time.

In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen

Answers

Answer:

Due to less concentration of carbondioxide gas.

Explanation:

Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.

uses of crush in the farm​

Answers

Answer:

ok i dont understand what that is

Explanation:

Answer: The overall purpose of a crush is to hold an animal still to minimise the risk of injury to both the animal and the operator while work on the animal is performed.

**anatomy & physiology question**

if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?

Answers

Answer:

0.8mm.

Explanation:

If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

What are the possible benefits of hybridization?

Answers

Answer: Advantages of hybridization are passing down favorable traits and prolonging the survival of a threatened or endangered species.

Hope this helps! ^^

Answer:

Advantages of hybridization include passing along favorable traits and prolonging the survival of a threatened or endangered species, but a disadvantage is that hybrid animals have more difficulty finding mates and successfully breeding. Hybridization occurs naturally and through human initiation.

A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?

Answers

Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

Explanation:

Answer:

hi

Explanation:

any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.

5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS

Answers

Answer:

800 km²

Explanation:

If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.

4000 x .20 = 800

800 km² is your answer.

If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

What do you mean by the researcher?

A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.

According to the question,

The total area of Gorongosa park = Gorongosa park is 4,000 km²

The area which is already studied = 20%.

Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².

The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].

Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].

To learn more about Researchers, refer to the link:

https://brainly.com/question/28136063

#SPJ2

Zara had a birthday and was able to choose a pet. The pet that she chose was a beautiful clownfish named Bozo, a common salt water fish. Zara already has a tank with goldfish at home. Use your knowledge of diffusion & osmosis to tell Zara how to take care of Bozo.

Answers

Answer:

See the answer below

Explanation:

The advice I would give  to Zara would be that she should keep Bozo in a separate tank with common salt water away from the goldfish. Bozo is a salt water fish while the goldfish can only survive in freshwater.

If Bozo is kept in a saltless water/freshwater tank with the goldfish, the water would be hypotonic to Bozo. Consequently, water will osmotically diffuse into the cells of Bozo, the cells would become turgid and lyse, and this would lead to the death of the fish.

If the goldfish is kept in the same salt water tank with Bozo, the salt water would be hypertonic to the goldfish. Consequently, water will osmotically diffuse out of the cells of the goldfish into the surrounding salt water, the cells of the goldfish would become flaccid, and this would lead to the death of the fish.

Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over time is the position of whales nostris. The images below show the skills of a modern whale
and its ancestor, Pakicatus
Nostrils at front
of skull
Nostrils at top
of skull
Pakicetus
Eschrichtius
cientists think that the position of the nostrils gives modern whales an evolutionary advantage. Which of the following most likely describes how this adaptation is advantageous?
O The nostril position allows whales to obtain air more easily at the surface of the water.
The nostril position allows whales to obtain food more easily at the surface of the water.
O The space lett empty by the migrating nostrils has allowed modern whales to develop gills.
The space left empty by the migrating nostrils has allowed modern whales to develop teeth.

Answers

Answer: Its A my friend, how it helps!.

Explanation: I just completed the Test.

The nostril position allows whales to obtain air more easily at the surface of the water is most likely describes the advantage of adaptation.

What do you mean by adaptation?

In biology, adaptation has three related meanings. It is the dynamic evolutionary process of natural selection that fits organisms to their environment, enhancing their evolutionary fitness. Secondly, it is a state reached by the population during that process.

The ability of living organisms to adjust themselves to their surroundings is called adaptation. Adaptations are the changes in structure or behaviour of an organism that will allow the organism to survive in that habitat.

Adaptations are unique characteristics that allow animals to survive in their environment. There are three types of adaptations: structural, physiological, and behavioral.

Learn more about adaptation:

https://brainly.com/question/12534888

#SPJ2

how did advancements in technology help scientists better understand process of cell division?

Answers

Answer:

As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.

Explanation:

Hoped I helped you out please mark me brainliest!!!

With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.

What is a microscope?

A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.

In most cases, the light is focused on the sample by passing it through a condenser.

After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.

The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.

Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.

For more details regarding microscope, visit:

https://brainly.com/question/18661784

#SPJ2

Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron​

Answers

Answer:

Oxygen

Explanation:

-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.

-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.

George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes

Answers

Answer:

A - peanuts, sweet potatoes, and soy

Explanation:

Answer:

I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...

Explanation:

Artificial selection applies only to dog breeding?

True OR False.

Answers

Answer:

Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.

true...?

Explanation:

Answer:

False.

Explanation:

The bananas we have today were created using artificial selection. Same thing with peanuts by the way.

how is cancer cell division different from regular cell division

Answers

It is different because it has different DNA and diff molecules
Other Questions
Solve using Graphing. x-y=-7 2x+9y=19 Marta put $4.89 in her coin bank. Each day she added 1 quarter, 1 nickel, and 6 pennies. How much does she add each day? How much money was in her coin bank after 6 days? please answer fast!!I am really confused and I don't know what to do. Valeria is playing with her accordion. The length of the accordion A(t)A(t)A, left parenthesis, t, right parenthesis (in \text{cm}cmstart text, c, m, end text) after she starts playing as a function of time ttt (in seconds) can be modeled by a sinusoidal expression of the form a\cdot\cos(b\cdot t)+dacos(bt)+da, dot, cosine, left parenthesis, b, dot, t, right parenthesis, plus, d. At t=0t=0t, equals, 0, when she starts playing, the accordion is 15\text{ cm}15 cm15, start text, space, c, m, end text long, which is the shortest it gets. 1.51.51, point, 5 seconds later the accordion is at its average length of 21\text{ cm}21 cm21, start text, space, c, m, end text. Find A(t)A(t)A, left parenthesis, t, right parenthesis. \textit{t}tstart text, t, end text should be in radians. Question 7 of 10Determine which postulate or theorem can be used to provethat ASEA = APEN.A. AASB.SASC.ASAD.SSS A dragon lived in a cave.The dragon doubled in size every day.After 20 days the dragon filled the cave.After how many days did the dragon half-fill the cave? 1) Why did the Confederates want to control Ft. Sumter? 2) What role did Ft. Sumter play in starting the Civil War? Will give brainliest Which side has a length of 10 units? Is this correct? If not plz get answers 25points!!! If each of the numbers in the following data set were multiplied by 17, whatwould be the median of the data set?28, 58, 20, 14, 18, 71, 36A. 986B. 1207C. 476D. 612 4+1/4 x + 3 = 10 pls help me Before the passage of the Indian Removal Act, some Plains Native American tribes BLANK to Indian territory. these tribes were often looking for better hunting grounds. After the Indian Removal Act, most tribes BLANK from there lands in the southeastern United States. the U.S government usually forced these tribes to give up there lands A butcher has 3 1 3 pounds of ground beef that will be priced at $1.35 per pound. He divides the meat into 8 equal packages. To the nearest cent, the price of each package is $ . what is 12+6x>99 help plz asaaap help pls !!!! order them from least to greatest What group of people did Louis draw from his advisor? When a person has to increase the amount of a drug to get the same high they have increased their ____A. tolerance for the drugB. acceptance for the drugc. ability to function with less of the drug name all of these if u really smart Who were some key people form the 1st Crusade?