Answer:
"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."
Explanation:
Hope this helps :)
Can someone please help me
Answer:
carbon dioxide plus water in the presence of light energy to sugar and oxygen
1. Energy transfer is inefficient between trophic levels because
A. Molecules are fully digested from each trophic level.
B. Dead organisms and waste are recycled throughout the trophic levels.
C. Organisms within a trophic level are fully consumed.
D. All organisms within a trophic level die.
2. Primary productivity is defined as
A. The rate that plants and other photosynthesis organisms produce organic compounds.
B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.
C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.
D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.
Thanks if you help, It's highly appreciated. :-)
Answer: b dead organisms And waste are recycled throughout the tropic levels.
Explanation:
Answer:
part 2
the rate that plants and other photosynthetic organisms produce organic compounds.
Explanation:
:)
The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.
What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?
An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.
The question to the above information is;
What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?
Answer;
An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
Explanation;
-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.
J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:
atoms are spheres of positive chargeelectrons are dotted around insideAnswer:
Its C on edge
Explanation:
Which of these is an advantage of fossil fuels? *
O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable
Answer:
reliable
Explanation:
Explanation:
Fossil fuels are a non-renewable resource.
“Fish and other wildlife become unhealthy and die without __________.”
Oxygen
Carbon Dioxide
Eutrophication
(This is 7th grade science)
Answer:
Oxygen
Explanation:
write a short paragraph on hydra
Answer:
at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)
Explanation:
What increases as you move from the surface to the interior of the Earth?
Answer:
Heat/temperature
Explanation:
"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.
Why is weather different from place to place?
Answer:
There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.
Explanation:
Hope this helps :)
Answer:
because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other
Explanation:
which is NOT part of the cell theory?
A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things
Answer:
B.
Explanation: Hope this helps! ^^
list one part of the cell theory in your own words, explain what it means
One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D
Answer:
C
Explanation:
it has the example figure number 7 and also it has the correct bisector
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
(GIVING BRAINLIEST) ______________ energy is the total potential and kinetic energy of particles in an object.
Group of answer choices
Chemical
Nuclear
Thermal
Answer:
Thermal
Explanation:
The total kinetic and potential energy of the particles in an object is called thermal energy.
PLSPLSPLS HELP ASAP
a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.
In what two ways can the minnow population be used to monitor the Lakes water quality?
Answer:
In the above case we can understand that,
If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.Answer: The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."
Explanation:
I got it right.
17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in
Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.
What is evaporation?As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.
It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.
Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.
Learn more about evaporation, here:
https://brainly.com/question/5019199
#SPJ5
PLEASE HELPPPPPPP
(Monstro the Goldfish & Epigenetics)
Answer:
mmmmmmmmmmmmdddddd
Explanation:
ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd
o
1. Which criteria are used to classify amphibians into orders?
Answer:
They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
what RNA nitrogen bases match with the following DNA nitrogen bases?
An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)
Answer:
The correct answer is - incomplete dominance.
Explanation:
In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.
In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).
What events must have occurred for fossils of marne organisms to be in a mountain far above sea level?
Answer:
el sapo
Explanation:
please answer this!!
Answer:
mouth coughing out biok sid carbon
What change to the following molecule's structure would result in a saturated fat?
Answer:
It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.
Explanation:
Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.
Hope this helped :)
6. A characteristic common to both diffusion and active transport is that
the movement of molecules occurs
energy is needed
oxygen is moved across a membrane
O
molecules move from low concentration to high concentration
Answer:
oxygen is moved across a membrane O, cause the others are untrue.
Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above
Answer:
on edge here's the correct answer
Explanation:
Answer: It is D)
Explanation:
Why are some theories more widely accepted than others such as the theory of evolution?
Answer:
Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.
Explanation:
I majored in Biology
write the code for RNA from this DNA STRAND :
AAAAAATTTTTTCCCGGGGTTTATATATC
Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
please help i will give brainlist
Answer:
I think it's c hope I hope I helped if not I'm sorry:(
Why do disruptive selection pressures tend to favor rapid evolutionary changes?
a. They result in sudden gene frequency changes.
b. They eliminate extreme genetic traits.
c. They select for one variation of a genetic trait.
d. They result in environmental adaptation.
Answer:
The correct answer is a. They result in sudden gene frequency changes.
Explanation:
The evolution of life, its diversity, is reduced to the processes of microevolution or speciation. But not all evolutionary processes in populations end with the formation of a new species. Disruptive selection is a type of natural selection that selects against the average individual in a population. The composition of this type of population would show phenotypes (individuals with groups of traits) of both extremes but with very few individuals in between. Disruptive selection tends to increase intra-population variability and, to this end, favors individuals at both ends of the phenotypic distribution, that is, as a final result there is a break in two different populations, which can lead to speciation.
Answer:
A"They result in sudden gene frequency changes."Explanation:
just took the test for edg and got it right